ID: 1046844986

View in Genome Browser
Species Human (GRCh38)
Location 8:118905638-118905660
Sequence ACTAGGTCTTTAAGGAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046844986_1046844994 23 Left 1046844986 8:118905638-118905660 CCATCCCTCCTTAAAGACCTAGT No data
Right 1046844994 8:118905684-118905706 ACATGATGTGAGTACCAACAAGG No data
1046844986_1046844995 29 Left 1046844986 8:118905638-118905660 CCATCCCTCCTTAAAGACCTAGT No data
Right 1046844995 8:118905690-118905712 TGTGAGTACCAACAAGGAGTCGG No data
1046844986_1046844996 30 Left 1046844986 8:118905638-118905660 CCATCCCTCCTTAAAGACCTAGT No data
Right 1046844996 8:118905691-118905713 GTGAGTACCAACAAGGAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046844986 Original CRISPR ACTAGGTCTTTAAGGAGGGA TGG (reversed) Intergenic
No off target data available for this crispr