ID: 1046846150

View in Genome Browser
Species Human (GRCh38)
Location 8:118919000-118919022
Sequence CACACCTAGCACCTTGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046846148_1046846150 9 Left 1046846148 8:118918968-118918990 CCTAGAAGCAGTGATACCTCAGT 0: 2
1: 4
2: 32
3: 91
4: 334
Right 1046846150 8:118919000-118919022 CACACCTAGCACCTTGATTGTGG No data
1046846149_1046846150 -7 Left 1046846149 8:118918984-118919006 CCTCAGTAGCAAAGAGCACACCT No data
Right 1046846150 8:118919000-118919022 CACACCTAGCACCTTGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046846150 Original CRISPR CACACCTAGCACCTTGATTG TGG Intergenic
No off target data available for this crispr