ID: 1046850855

View in Genome Browser
Species Human (GRCh38)
Location 8:118971307-118971329
Sequence GTTTCTATGCTGAAAGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046850854_1046850855 -8 Left 1046850854 8:118971292-118971314 CCTCTGGATGATTGAGTTTCTAT No data
Right 1046850855 8:118971307-118971329 GTTTCTATGCTGAAAGTCATAGG No data
1046850853_1046850855 5 Left 1046850853 8:118971279-118971301 CCTTGCAAGGTCACCTCTGGATG No data
Right 1046850855 8:118971307-118971329 GTTTCTATGCTGAAAGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046850855 Original CRISPR GTTTCTATGCTGAAAGTCAT AGG Intergenic
No off target data available for this crispr