ID: 1046852150

View in Genome Browser
Species Human (GRCh38)
Location 8:118986829-118986851
Sequence TCTATAAATTTACCTGTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046852150_1046852156 22 Left 1046852150 8:118986829-118986851 CCTAAAACAGGTAAATTTATAGA No data
Right 1046852156 8:118986874-118986896 GGTATAGGATGTGGAAGGAATGG No data
1046852150_1046852152 1 Left 1046852150 8:118986829-118986851 CCTAAAACAGGTAAATTTATAGA No data
Right 1046852152 8:118986853-118986875 ACAGAAAATTGGTAGTTTTCAGG No data
1046852150_1046852158 24 Left 1046852150 8:118986829-118986851 CCTAAAACAGGTAAATTTATAGA No data
Right 1046852158 8:118986876-118986898 TATAGGATGTGGAAGGAATGGGG No data
1046852150_1046852153 7 Left 1046852150 8:118986829-118986851 CCTAAAACAGGTAAATTTATAGA No data
Right 1046852153 8:118986859-118986881 AATTGGTAGTTTTCAGGTATAGG No data
1046852150_1046852154 13 Left 1046852150 8:118986829-118986851 CCTAAAACAGGTAAATTTATAGA No data
Right 1046852154 8:118986865-118986887 TAGTTTTCAGGTATAGGATGTGG No data
1046852150_1046852151 -10 Left 1046852150 8:118986829-118986851 CCTAAAACAGGTAAATTTATAGA No data
Right 1046852151 8:118986842-118986864 AATTTATAGACACAGAAAATTGG No data
1046852150_1046852155 17 Left 1046852150 8:118986829-118986851 CCTAAAACAGGTAAATTTATAGA No data
Right 1046852155 8:118986869-118986891 TTTCAGGTATAGGATGTGGAAGG No data
1046852150_1046852157 23 Left 1046852150 8:118986829-118986851 CCTAAAACAGGTAAATTTATAGA No data
Right 1046852157 8:118986875-118986897 GTATAGGATGTGGAAGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046852150 Original CRISPR TCTATAAATTTACCTGTTTT AGG (reversed) Intergenic
No off target data available for this crispr