ID: 1046852155

View in Genome Browser
Species Human (GRCh38)
Location 8:118986869-118986891
Sequence TTTCAGGTATAGGATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046852150_1046852155 17 Left 1046852150 8:118986829-118986851 CCTAAAACAGGTAAATTTATAGA No data
Right 1046852155 8:118986869-118986891 TTTCAGGTATAGGATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046852155 Original CRISPR TTTCAGGTATAGGATGTGGA AGG Intergenic
No off target data available for this crispr