ID: 1046854444

View in Genome Browser
Species Human (GRCh38)
Location 8:119015305-119015327
Sequence CCTAATGGGCAGACAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046854444_1046854454 -1 Left 1046854444 8:119015305-119015327 CCTCCCACTGTCTGCCCATTAGG 0: 1
1: 0
2: 0
3: 6
4: 170
Right 1046854454 8:119015327-119015349 GTAGGACAGGATGGCTGGTGTGG No data
1046854444_1046854456 4 Left 1046854444 8:119015305-119015327 CCTCCCACTGTCTGCCCATTAGG 0: 1
1: 0
2: 0
3: 6
4: 170
Right 1046854456 8:119015332-119015354 ACAGGATGGCTGGTGTGGGCTGG No data
1046854444_1046854450 -10 Left 1046854444 8:119015305-119015327 CCTCCCACTGTCTGCCCATTAGG 0: 1
1: 0
2: 0
3: 6
4: 170
Right 1046854450 8:119015318-119015340 GCCCATTAGGTAGGACAGGATGG No data
1046854444_1046854455 0 Left 1046854444 8:119015305-119015327 CCTCCCACTGTCTGCCCATTAGG 0: 1
1: 0
2: 0
3: 6
4: 170
Right 1046854455 8:119015328-119015350 TAGGACAGGATGGCTGGTGTGGG No data
1046854444_1046854457 11 Left 1046854444 8:119015305-119015327 CCTCCCACTGTCTGCCCATTAGG 0: 1
1: 0
2: 0
3: 6
4: 170
Right 1046854457 8:119015339-119015361 GGCTGGTGTGGGCTGGAGTTTGG No data
1046854444_1046854453 -6 Left 1046854444 8:119015305-119015327 CCTCCCACTGTCTGCCCATTAGG 0: 1
1: 0
2: 0
3: 6
4: 170
Right 1046854453 8:119015322-119015344 ATTAGGTAGGACAGGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046854444 Original CRISPR CCTAATGGGCAGACAGTGGG AGG (reversed) Intronic
900039903 1:451271-451293 CATAATGGTCAGATAGTGGAGGG + Exonic
900061335 1:686247-686269 CATAATGGTCAGATAGTGGAGGG + Exonic
900404505 1:2486504-2486526 CGGCTTGGGCAGACAGTGGGAGG + Intronic
905225024 1:36473382-36473404 CAAAATGGGCAGACACTGAGAGG - Intronic
907417559 1:54324916-54324938 CCAAATGTGAAGACAATGGGAGG + Intronic
908268932 1:62404249-62404271 CATAATTGGCAGGCAGAGGGAGG + Intergenic
915489336 1:156242668-156242690 CCTGATGGCCAGACAGGAGGTGG - Intronic
915754916 1:158250178-158250200 CTGTATGGGCAGACAGTGGCAGG + Intergenic
916682355 1:167116036-167116058 CCTGATGGGCAGTCTCTGGGTGG - Intronic
918730027 1:187981550-187981572 CGTAATGAGAAGACACTGGGGGG - Intergenic
919388635 1:196954161-196954183 CCATATGGGCAGAAAGTTGGAGG - Intronic
920645464 1:207800462-207800484 CCCAGTGGGCTGAGAGTGGGGGG - Intergenic
923558089 1:235017481-235017503 GCTATTGGGTAGACTGTGGGAGG + Intergenic
1067718444 10:48707905-48707927 TCTAAGGGGCAGGCAGTGTGTGG - Intronic
1070119287 10:73559931-73559953 CCTACTGGGGAGACAGAGGCAGG + Intronic
1070805838 10:79270200-79270222 CCTAACGGACAGACAGTATGGGG + Intronic
1075799935 10:125147320-125147342 CCTGATGGGCAGCCAGGGTGGGG - Intronic
1075922071 10:126221984-126222006 TCTGATGGACAGCCAGTGGGTGG - Intronic
1076469668 10:130709799-130709821 CCTATAGGGCAGAGAGTGGGAGG - Intergenic
1076966127 11:87180-87202 CATAATGGTCAGATAGTGGCGGG + Intergenic
1079131918 11:17751783-17751805 CCTGAAGGGCAGTCAGTGAGTGG + Intronic
1080751434 11:35153889-35153911 CCCAATGGTGAGACAGTGAGAGG - Intronic
1080972154 11:37290825-37290847 CATAATGGGCAAACATTTGGTGG + Intergenic
1081646954 11:44796745-44796767 CCTAGAGGACAGACAGAGGGTGG - Intronic
1083816827 11:65137547-65137569 CCTGAAGGGCAGAGTGTGGGAGG - Intergenic
1085444318 11:76590342-76590364 CCTCATGGTAAGGCAGTGGGGGG - Intergenic
1085477424 11:76796998-76797020 CGCAATGGGCAGAGGGTGGGTGG + Exonic
1086108104 11:83169015-83169037 CCTCATGGTCAGCCTGTGGGTGG + Exonic
1086942549 11:92813531-92813553 CCAAAGGGGCAGCAAGTGGGAGG - Intronic
1088663295 11:112069748-112069770 CCTAGTAGGCAGACATTGTGAGG - Intronic
1089270262 11:117297038-117297060 TCTAAGGGGCAGACTGTGGCTGG - Intronic
1089735323 11:120546777-120546799 CCTAGTAGCCACACAGTGGGAGG - Intronic
1089884237 11:121803858-121803880 CCTATTGCCCAGAAAGTGGGGGG + Intergenic
1091236931 11:134028452-134028474 CCTAAGGAGCAGACAGTGTCGGG - Intergenic
1096416138 12:51415757-51415779 CCAAAAGGGGAGAGAGTGGGAGG + Intronic
1099028447 12:77495000-77495022 TTGAATGTGCAGACAGTGGGAGG + Intergenic
1099693621 12:85992421-85992443 CCTAATGGGCAGTCAGGGACTGG - Intronic
1101968730 12:109297796-109297818 CCTATTGGGGAGACACTGCGAGG - Intronic
1108791243 13:53971877-53971899 CCTTGTGGGCAGACAGGGAGGGG + Intergenic
1110651878 13:77951488-77951510 ACTAATGGACAGAAATTGGGAGG + Intergenic
1115085524 14:29510798-29510820 CCTAATGGGGAGGCATTGGATGG - Intergenic
1119160661 14:72449820-72449842 CCTGAGGGGTAAACAGTGGGAGG - Intronic
1121014278 14:90538961-90538983 CCTAATAGGATGCCAGTGGGGGG - Exonic
1121714330 14:96062217-96062239 CCTAGTGGGCAGACTGTGGAAGG - Intronic
1122896405 14:104759718-104759740 CCAAAGGAGCAGTCAGTGGGCGG + Intronic
1126201116 15:45987269-45987291 CATACTGGGCAGCCAGGGGGAGG + Intergenic
1127396805 15:58549804-58549826 CCTAAGGGACAGCCAGTGGAGGG - Intronic
1127726929 15:61759515-61759537 CTAAGTAGGCAGACAGTGGGAGG - Intergenic
1131005535 15:88974433-88974455 CCTACAGGGCAGACGGTGAGAGG - Intergenic
1132442004 15:101876348-101876370 CATAATGGTCAGATAGTGGAGGG - Intergenic
1132847545 16:2007374-2007396 CCTTACAGGCAGGCAGTGGGAGG - Intronic
1133317015 16:4891179-4891201 CCTCATGACCAGACAGTGGCAGG - Intronic
1133738984 16:8637563-8637585 CCAAATGGGCAGACTGAGGCTGG + Intronic
1133838268 16:9385765-9385787 TTTGATGGGAAGACAGTGGGAGG - Intergenic
1141134882 16:81458603-81458625 CGTAATGGGGAAACAGTGTGCGG - Intronic
1142060767 16:88027713-88027735 CCTCAGGGGCAGCCAGTGCGTGG + Intronic
1144495519 17:15742639-15742661 CCTCATGGGCAGACTGGGGCAGG + Intronic
1145067405 17:19771120-19771142 CCTAAGGGTGAGACAGTGTGGGG + Intronic
1147857473 17:43493268-43493290 CCTCATGGGGAGACATGGGGTGG - Intronic
1149777278 17:59367859-59367881 TGTAATGGGAAGACAGTGTGGGG + Intronic
1152425315 17:80215289-80215311 CCTATCGGGCAGGGAGTGGGAGG - Intronic
1153407460 18:4757180-4757202 CATAATGTGCAGTCAGTTGGAGG + Intergenic
1156405154 18:36776266-36776288 CCTGATGGGGACACAGTGTGGGG - Intronic
1160642929 19:156810-156832 CATAATGGTCAGATAGTGGAGGG + Intergenic
1161052483 19:2171751-2171773 CCTCAGGGGGACACAGTGGGCGG - Intronic
1162153966 19:8664361-8664383 GCTGATGGGCAGGAAGTGGGGGG - Intergenic
1163234546 19:16023001-16023023 CCTCATGGGCAGACAGGGCCAGG + Intergenic
1167715512 19:51140602-51140624 CCTTATGGGGAGAGAGTGGCTGG + Intergenic
925242538 2:2344822-2344844 CCTAAAGGGCACCCATTGGGTGG - Intergenic
926713327 2:15901738-15901760 CCTAATGGGTATAAAGTGGTGGG - Intergenic
927644420 2:24867873-24867895 ACTAATAAGCAGAAAGTGGGGGG + Intronic
927682042 2:25146206-25146228 CCTAATGGGCAGAGAGGCTGGGG - Intronic
927937557 2:27084195-27084217 CCTAGTGAGCAGCCAGAGGGAGG - Intronic
930109505 2:47666579-47666601 CCTAATGGGAATAAACTGGGGGG - Intergenic
933563890 2:83925294-83925316 CATAATGGGCAGGCAGAGGAGGG + Intergenic
934090873 2:88549655-88549677 CCTGCTGGGCAGCCAGAGGGTGG - Intergenic
934858493 2:97743906-97743928 CCTAATGGGTAGGTGGTGGGGGG + Intergenic
935360946 2:102245780-102245802 CCTCAGGGGCAGACAGAGCGAGG - Intergenic
937119662 2:119432597-119432619 CCCAAAGGGAAGTCAGTGGGTGG + Intronic
938159488 2:128972831-128972853 CCCAGTGGCCAGACAGTGGCAGG - Intergenic
941976344 2:171409431-171409453 CCTGATTGCTAGACAGTGGGAGG - Intronic
947491021 2:230594327-230594349 CCCCAGGGGCAGACAGTGGTGGG + Intergenic
1170277057 20:14602914-14602936 CCTAATGGGAATACAGTGTAAGG + Intronic
1171155008 20:22864089-22864111 GGTCATGGGGAGACAGTGGGTGG - Intergenic
1172700143 20:36848261-36848283 CCTTGTGGGCAGGGAGTGGGTGG - Intronic
1172854966 20:37994679-37994701 CCTGATGGGCAGGGAGGGGGAGG - Intronic
1175415896 20:58800736-58800758 GCGAATGAGCAGACAGTGGACGG - Intergenic
1179553774 21:42159865-42159887 CATCATGGGATGACAGTGGGGGG + Intergenic
1180190958 21:46162185-46162207 TCTATTTGCCAGACAGTGGGGGG - Intronic
1180840558 22:18957037-18957059 CCTGATGCGCAGGCAGTGGCTGG + Intergenic
1181448734 22:23001407-23001429 GGTAATGGGCAGAGTGTGGGGGG - Intergenic
1181842917 22:25680224-25680246 CTTAATGCCCATACAGTGGGAGG - Intronic
1182296935 22:29315444-29315466 CCGAGTGGGCAGACAGGTGGCGG + Exonic
1182546936 22:31081945-31081967 CCTAACAGGCAGAGATTGGGAGG + Intronic
1182549112 22:31091490-31091512 CCCATTGGGGAGGCAGTGGGGGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183264202 22:36815721-36815743 CCTCAAGGTCATACAGTGGGAGG + Intronic
1183868237 22:40721171-40721193 CCTACAGGGCAGTCAGTGTGGGG - Intergenic
1184575135 22:45357877-45357899 CCTAATGAGCTGACTGTTGGAGG + Intronic
949419225 3:3847840-3847862 CCTAATGGGCAGTGGGAGGGTGG + Intronic
950117046 3:10457871-10457893 TCTAAGGGGCAGGCAGTGAGAGG + Intronic
950504559 3:13386628-13386650 CACAATGGGCAGTCAGTGTGAGG - Intronic
950623610 3:14227579-14227601 TCTAATGGTAAGGCAGTGGGCGG - Intergenic
950991421 3:17442379-17442401 CCTGTTGTGCAGACAGTGAGTGG + Intronic
954807592 3:53229463-53229485 CCAAAGGGGCAGGCAGAGGGTGG + Intronic
954936374 3:54330724-54330746 CCTCTTGGCCAGCCAGTGGGTGG + Intronic
956274889 3:67488343-67488365 CCTAATTCTCTGACAGTGGGTGG + Intronic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
961159412 3:124710285-124710307 TCTATTGGGAAGACAGTGGTTGG + Intronic
964762467 3:160147197-160147219 CCAAAAGGGGAGACAGAGGGAGG - Intergenic
968514318 4:1009919-1009941 CCGAATGAGCGGGCAGTGGGAGG - Intronic
968660626 4:1797374-1797396 CCTAGCAGGCAGGCAGTGGGGGG + Intronic
968688305 4:1976114-1976136 CCTAATGAGGAGACCCTGGGTGG + Intronic
970243885 4:14038326-14038348 TCTAATGGTCAGAGAGTGAGGGG + Intergenic
972370072 4:38414975-38414997 CTTCCTGGGCTGACAGTGGGTGG - Intergenic
974070727 4:57121167-57121189 GCTAATGGGGAGTCTGTGGGAGG + Intergenic
975647878 4:76563674-76563696 TCAAGTGGGCAGGCAGTGGGAGG + Intronic
976645545 4:87383927-87383949 ACTAATGGGCAGACCCTAGGAGG + Intronic
978362147 4:107942285-107942307 GCTGAGGTGCAGACAGTGGGTGG - Intronic
980129239 4:128803202-128803224 CCTGATGGGCAGTGAGTAGGTGG - Intergenic
983008995 4:162521775-162521797 CCTAATGGAAAGACTATGGGTGG + Intergenic
983954448 4:173680589-173680611 CGTGATGGGAAGACATTGGGGGG + Intergenic
983987574 4:174078820-174078842 TCTGATGGGCAGGCATTGGGTGG - Intergenic
985516818 5:350586-350608 CCTAGTGGGCAGACAGCAGCTGG - Intronic
985927923 5:3032221-3032243 CTTCATGGGCACACGGTGGGTGG - Intergenic
986054143 5:4119288-4119310 CCTAAGGAGCAGACAGTAGGAGG + Intergenic
989526045 5:42454822-42454844 CCTTGTGGGCAGACAGGGAGGGG - Intronic
989760090 5:45004704-45004726 CCTAGGGGGTTGACAGTGGGAGG + Intergenic
997267084 5:132501247-132501269 CTTGCTGGGCAGACAGCGGGGGG - Intergenic
998369653 5:141652665-141652687 CACAGTGAGCAGACAGTGGGAGG - Intergenic
1000480129 5:161763188-161763210 CTTAATGACCAGAGAGTGGGGGG - Intergenic
1001724503 5:173885726-173885748 CCTTATGTGTAGACAGAGGGAGG + Intergenic
1002375999 5:178789554-178789576 CCTCATGGGCTGGTAGTGGGAGG - Intergenic
1002733944 5:181367672-181367694 CATAATGGTCAGATAGTGGAGGG - Exonic
1002750599 6:106450-106472 CATAATGGTCAGATAGTGGAGGG + Intergenic
1006042938 6:31270438-31270460 CCTCATGGTCAGAGAGGGGGTGG + Exonic
1006309773 6:33249514-33249536 CCTAATTGGCGGACGCTGGGGGG - Intergenic
1014805111 6:125820730-125820752 GCTCATGGGCTGAAAGTGGGAGG - Intronic
1015795945 6:137011293-137011315 CCAAATGGGCTGAAAGTGGACGG - Exonic
1017554231 6:155545727-155545749 ATTAATGGGCAGAGGGTGGGTGG + Intergenic
1018590631 6:165417735-165417757 GCTGAGGGGCAGACAGTGGTGGG + Intronic
1018655632 6:166033010-166033032 GCTCATGGCCAGCCAGTGGGCGG - Intergenic
1019238191 6:170639990-170640012 CATAATGGTCAGATAGTGGAGGG - Intergenic
1019354218 7:570517-570539 ACTGCTGGGCAGGCAGTGGGGGG - Intronic
1020527865 7:9286703-9286725 ACTAATGTGCAGACAGGAGGAGG + Intergenic
1021842043 7:24728698-24728720 CCTGCGGGGGAGACAGTGGGCGG - Intronic
1025980347 7:66400113-66400135 CCTAATAGGAAGACAATTGGAGG + Intronic
1026289654 7:68994938-68994960 CCTAATGGGGAGGAAGTGAGGGG + Intergenic
1029950962 7:104585150-104585172 GCTAGAGGGCAGACAGTAGGAGG - Intronic
1030425419 7:109370813-109370835 ACTAAAGGGAAGACAGTGGTTGG + Intergenic
1030918777 7:115352751-115352773 GCTCATGGGAAGACAGTGGGAGG + Intergenic
1034490835 7:151392342-151392364 CCTAATGAGGAGTCAGTGGTGGG - Intronic
1035509576 8:166617-166639 CATAATGGTCAGATAGTGGAGGG + Exonic
1037944725 8:22981703-22981725 CTTCAGGGGCAGGCAGTGGGGGG - Intronic
1041976712 8:63807575-63807597 CATAATGGGTAGAAAGTGGGTGG - Intergenic
1042892380 8:73626954-73626976 CCTGGTGGTCAGACAGTGTGTGG + Intronic
1044008563 8:86965273-86965295 CCTAATGGGCAGTCAGGGATTGG + Intronic
1044531837 8:93316271-93316293 CCAGATGGGCAGACAGTCTGTGG - Intergenic
1045481482 8:102596454-102596476 CCTAATGAGCAGGGAGGGGGTGG - Intergenic
1046854444 8:119015305-119015327 CCTAATGGGCAGACAGTGGGAGG - Intronic
1049224078 8:141441379-141441401 CGCAGTGGGCAGCCAGTGGGTGG - Intergenic
1051038185 9:12775269-12775291 CCAGATGGGCAGTCAGTGAGCGG + Exonic
1051721534 9:20042105-20042127 CCTGGTGGGCAGACTGTGGCAGG + Intergenic
1051777326 9:20650208-20650230 CCTGGAGGGCAGAAAGTGGGAGG + Intergenic
1051785984 9:20744137-20744159 CTTCATGGTCAGACGGTGGGTGG + Intronic
1055760660 9:79604097-79604119 TATAATGGCCAGAGAGTGGGAGG + Intronic
1058120732 9:101135837-101135859 CCTGCTGGGCAGACAGAGGCAGG - Intronic
1061826305 9:133260447-133260469 AGTCATGGGCAGACAGTGGCTGG - Intronic
1062573034 9:137194295-137194317 CCAAGTGGGCTGGCAGTGGGTGG - Intronic
1062758397 9:138320282-138320304 CATAATGGTCAGATAGTGGAGGG - Intergenic
1190297699 X:49038280-49038302 CCTCAGGGGCAGGCAGTGGCTGG + Exonic
1190722425 X:53161033-53161055 TCTAATGGTAAGGCAGTGGGTGG + Intergenic
1192770084 X:74180007-74180029 TCTAATGGTAAGGCAGTGGGCGG - Intergenic
1193329836 X:80223644-80223666 CCTAATTGGGAGAAAGTGGGAGG - Intergenic
1195538268 X:106033691-106033713 CCTTATGGGCAGCCTGTGTGGGG + Exonic
1196673574 X:118395264-118395286 CCTGATGGGCAGACTGTAGCAGG + Exonic
1198843413 X:140882918-140882940 CCTTAAGGGTAGAGAGTGGGAGG + Intergenic