ID: 1046854491

View in Genome Browser
Species Human (GRCh38)
Location 8:119015732-119015754
Sequence CAAACTACTGCCCCTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 13, 3: 50, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046854491_1046854495 20 Left 1046854491 8:119015732-119015754 CCAATTTCAGGGGCAGTAGTTTG 0: 1
1: 0
2: 13
3: 50
4: 190
Right 1046854495 8:119015775-119015797 TGGTTTTCTTCAGTTTCCTTAGG No data
1046854491_1046854492 0 Left 1046854491 8:119015732-119015754 CCAATTTCAGGGGCAGTAGTTTG 0: 1
1: 0
2: 13
3: 50
4: 190
Right 1046854492 8:119015755-119015777 TCCTGTACCTGAGAAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046854491 Original CRISPR CAAACTACTGCCCCTGAAAT TGG (reversed) Intronic
900723308 1:4194804-4194826 CAAACTACTGTCCCCCAAATTGG - Intergenic
903824160 1:26130660-26130682 CAAACTGCTGCCCCTGTAATTGG + Intergenic
904389221 1:30170079-30170101 CACGCTGCTGCCCCTGAGATGGG + Intergenic
905287756 1:36894584-36894606 CAAACCACTGCCCCCAGAATTGG + Intronic
905964989 1:42085001-42085023 CAAACCACTGCCCTAAAAATTGG - Intergenic
906615401 1:47229912-47229934 GAAAGTACAGCCCCTGGAATTGG - Intronic
908793313 1:67804637-67804659 CAAACCACTGCCCCAAAAGTTGG + Intronic
910161356 1:84275978-84276000 CAAACTGCTGTCCCCCAAATTGG - Intergenic
910372958 1:86537447-86537469 CAAACTGCTGCCCCCAAAATAGG - Intergenic
910937106 1:92493385-92493407 AAACCTACTGCCCCTACAATGGG - Intergenic
911127164 1:94351381-94351403 CAAACAACAGCACCTGAGATGGG + Intergenic
915451253 1:156006958-156006980 CAAGCTGCAGCCCCTGAAAGAGG + Intronic
916720127 1:167478563-167478585 CACACTACTGCCTCTCCAATTGG - Intronic
916760450 1:167811669-167811691 CAAACTGCTGCCCCTAAGACTGG + Intronic
917591923 1:176484980-176485002 CAAACCATTGCCCCTTAAATTGG - Intronic
920795636 1:209133673-209133695 CAAACTGATGCCCCCGGAATTGG + Intergenic
921474254 1:215586977-215586999 CAAACTACTGAACCTGAATGTGG + Intronic
921605229 1:217144499-217144521 CAAACAACTGTCCCAAAAATTGG + Intergenic
921768986 1:219011333-219011355 CAAACCACTGCCCCCGGAATGGG - Intergenic
923925272 1:238620073-238620095 CAAATTTCTGCCCCCTAAATCGG + Intergenic
1063807804 10:9667149-9667171 CAAACTACGGCCACTAAAAGTGG - Intergenic
1065430850 10:25653989-25654011 CAAACCAGAGCCACTGAAATGGG + Intergenic
1065606756 10:27426201-27426223 GGAACTTCTGCCACTGAAATGGG + Intergenic
1066020110 10:31290061-31290083 CAAACTGCTGCCTCCGAAAATGG + Intergenic
1066041665 10:31554378-31554400 CAAACCACTTCCCCCAAAATTGG + Intergenic
1066162558 10:32749137-32749159 CAAACTGCTGCCCCCAAAACTGG - Intronic
1068816596 10:61322471-61322493 CAATCTAATGCCCCCCAAATGGG + Intergenic
1069406013 10:68099325-68099347 AACACTCCTGCCCTTGAAATTGG - Intergenic
1070824465 10:79382666-79382688 CCAACGACTAACCCTGAAATGGG - Exonic
1072825588 10:98603145-98603167 CAAACCACTGCCCCCAAAATTGG + Intronic
1073330748 10:102668690-102668712 CAAACTTCTGCCTCCAAAATGGG + Intergenic
1074358565 10:112806906-112806928 AAAACTCCTGCCTCTGGAATAGG - Intronic
1076084270 10:127611272-127611294 CAAACTGCTGTCCCCTAAATTGG - Intergenic
1076273928 10:129180508-129180530 CAAAATAATTCCCCTGAAAACGG + Intergenic
1076827017 10:132974196-132974218 CAAACCACAGCCTCTGAATTTGG - Intergenic
1077520607 11:3031643-3031665 CAAACCACTGCCCCCTAAACTGG + Intronic
1080416968 11:32077869-32077891 CAAAGTACTGACCCTTAAAAGGG + Intronic
1083078073 11:60062267-60062289 CAAAATGCTGCCACTGGAATTGG + Intronic
1083688712 11:64393162-64393184 CCACCTACTGTCCCTGAAGTTGG + Intergenic
1084916901 11:72435236-72435258 GTAACTACTGCACCTGAGATAGG + Intergenic
1085539102 11:77249562-77249584 CAAACTGCTGCCCAGAAAATTGG + Intronic
1085775474 11:79362250-79362272 CAAGCCTCTGCACCTGAAATTGG - Intronic
1086036734 11:82424899-82424921 CAAACTGCTGCCCCCAAAACTGG + Intergenic
1086392688 11:86381643-86381665 CAAACTGCTGCCCCTAAAATTGG - Intronic
1087419176 11:97898706-97898728 CAAACTACTGCCCCCAAAACTGG + Intergenic
1088162776 11:106893676-106893698 CAAACCACTGCCCCTAAAACTGG + Intronic
1089353885 11:117837373-117837395 CAGACTACAGTCCCTGCAATTGG - Exonic
1090057866 11:123438897-123438919 CAAACTGCTGGCCCTGAAGCAGG + Intergenic
1090768744 11:129899524-129899546 CAAACTGCTGTCCCCAAAATTGG - Intergenic
1090852161 11:130580096-130580118 CCAACTACTGCTCCTTAAGTGGG - Intergenic
1091876007 12:3933479-3933501 TAAACTGCTGCCCCCAAAATTGG + Intergenic
1091965447 12:4737218-4737240 CAAACTGCTTCCCCCAAAATTGG + Intronic
1092806196 12:12225346-12225368 CAAACCACTGCCCCCACAATTGG + Intronic
1094204184 12:27823314-27823336 CAAAATACAGCACTTGAAATAGG + Intergenic
1095618618 12:44222658-44222680 GAAACTCCTGCCCATGAAAATGG - Intronic
1097718470 12:62994118-62994140 CAAACCACTGCCCCTAAAATTGG - Intergenic
1097896653 12:64830499-64830521 CAAGGTAATGCCCCTGAACTTGG + Exonic
1099019576 12:77386715-77386737 CAGACTACTGACCTGGAAATAGG + Intergenic
1099834195 12:87886644-87886666 GGAACAACTGCCACTGAAATGGG - Intergenic
1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG + Intronic
1100892105 12:99137140-99137162 CCAAATACTGCCATTGAAATGGG + Intronic
1104762060 12:131302978-131303000 GAAACTTGTGTCCCTGAAATAGG - Intergenic
1104817716 12:131657806-131657828 GAAACTTGTGTCCCTGAAATAGG + Intergenic
1105795186 13:23844449-23844471 CAAACTGCTGCCCCCAAAACTGG + Intronic
1110214506 13:73011166-73011188 CAAACTGCTGCCCCCAAAATTGG + Intronic
1110827253 13:79987034-79987056 CAAACTTCTGTTCCTCAAATTGG - Intergenic
1112229250 13:97571231-97571253 GAAACAACAGGCCCTGAAATAGG + Intergenic
1113441632 13:110333609-110333631 CGACCTACTGCACCTGAGATGGG + Intronic
1114466899 14:22929420-22929442 CAAACTAGTGCCCCAGAAGGCGG + Exonic
1114644491 14:24247093-24247115 CAAACTGCTGCCCCTAAAACTGG - Intergenic
1114728470 14:24964890-24964912 CGAAGTCCTGTCCCTGAAATGGG - Intronic
1116810973 14:49540057-49540079 CAAACTTCTGCCCATAAAATTGG + Intergenic
1118889883 14:69899923-69899945 CAAACCACTGCCCCCAAAATTGG - Intronic
1122258236 14:100495656-100495678 CAAACCACTGCCCCCAAAACTGG - Intronic
1122806160 14:104259635-104259657 CAAACTGCTGTCCCTCAAATTGG + Intergenic
1123012209 14:105354930-105354952 CAACCTGCTGCCCATGAGATCGG - Intronic
1125266464 15:37886963-37886985 CAAACTACTTCCCATGAGTTTGG + Intergenic
1125719401 15:41838176-41838198 CCACCTGCTGCCCCTGAACTGGG - Intronic
1125846384 15:42858654-42858676 CAAACTGCTGCCTCCAAAATTGG + Intronic
1126328760 15:47509756-47509778 CAAAGTATTGCCCCTGAACTAGG + Intronic
1126611260 15:50531951-50531973 CAAACCACTGCCCCCAAAACTGG + Intronic
1129997786 15:80021722-80021744 CAAACTGCTGCCCCCAAAATTGG - Intergenic
1130242200 15:82204948-82204970 TCAACTACTGTACCTGAAATAGG + Intronic
1130458174 15:84135874-84135896 TCAACTACTGTACCTGAAATAGG - Intergenic
1130581839 15:85144602-85144624 CAAACTGCTGCCCCTAAGATAGG + Intergenic
1132898500 16:2240176-2240198 CACCCCACTGCCCCTGAAAGTGG - Intronic
1134741357 16:16549932-16549954 CCAACTGCTGCCCCAGTAATAGG + Intergenic
1134926201 16:18162509-18162531 CCAACTGCTGCCCCAGTAATAGG - Intergenic
1135800764 16:25492945-25492967 CAAACCACTGCCCCCAACATTGG - Intergenic
1138176209 16:54900561-54900583 CAAACTGCTGCCTCTGAAATTGG + Intergenic
1138382808 16:56615260-56615282 GAAACTGCTGCCACTGAATTGGG - Intergenic
1138790279 16:59895675-59895697 GAAACTACTGCCCCTCAAATTGG - Intergenic
1140682647 16:77400408-77400430 CACACAATTCCCCCTGAAATAGG - Intronic
1144200545 17:12937566-12937588 CAAACTGCTGCCCTGAAAATTGG - Intronic
1144367100 17:14555153-14555175 CAAACAGCTGCCCCTTAAAGAGG + Intergenic
1146106264 17:30039962-30039984 CAAACCAGTGCCACTGAAACAGG + Intronic
1149490302 17:57079814-57079836 CAAACATGTGCCCCTGAAATTGG + Intergenic
1149722026 17:58854880-58854902 CAAACTGCTGCTCCCAAAATTGG + Intronic
1149929924 17:60741170-60741192 CAAACTGCTGCCCCAAAAATTGG - Intronic
1150140143 17:62721166-62721188 CAAATCACTGCCCCTAAAATTGG - Intronic
1153751797 18:8239667-8239689 CAAACCACTGCCCCCCAAATTGG - Intronic
1156716731 18:40021374-40021396 CAAACTGCTGCCCCCAAAATTGG + Intergenic
1156933407 18:42673039-42673061 CAAACTGCTGCCCCCAAAATTGG + Intergenic
1157509439 18:48259677-48259699 CAAACAACTGTCCCTCAAATGGG + Intronic
1158473758 18:57761534-57761556 CAATCTACTGAACCTGGAATGGG + Intronic
1164703159 19:30300592-30300614 CAAACTATTGCCCCTCAGTTGGG - Intronic
1166533075 19:43553961-43553983 CAAACTCCTGCCTGTGGAATGGG + Intronic
925784551 2:7418450-7418472 CAAACTACTGTTCCTCAAATTGG - Intergenic
927498781 2:23568076-23568098 CAAACTGCAGGCTCTGAAATGGG - Intronic
928490321 2:31777323-31777345 CAAACCACTGCTCCAAAAATTGG + Intergenic
930552593 2:52853812-52853834 CAAACTGCTGCCCCCCAAATTGG - Intergenic
931833959 2:66080034-66080056 AGAACTTCTGCCCCTGAAATGGG - Intergenic
932510491 2:72283381-72283403 TAAACTGCTGCCTCTCAAATTGG + Intronic
934937673 2:98477135-98477157 CAGTCTCCTGCTCCTGAAATGGG - Intronic
936620725 2:114094334-114094356 CAAACCACTGCCCCTCAAATTGG - Intergenic
939184254 2:138841673-138841695 CAAAGTACTGCCCCCTATATGGG + Intergenic
940301964 2:152184801-152184823 CAAACTACTGCCCTCAAAATTGG - Intergenic
941266242 2:163366522-163366544 CAAACTGCTCCCCCCAAAATTGG - Intergenic
941914426 2:170800653-170800675 CAAAATGCTTCCCCTCAAATCGG - Intergenic
942364634 2:175211729-175211751 CAAACCACTGCCTCCAAAATTGG - Intergenic
947073756 2:226319311-226319333 CAAAGTCCTGCTCCTCAAATGGG + Intergenic
947300568 2:228684221-228684243 AAAACTGCTGCCCCCAAAATTGG + Intergenic
1169810999 20:9609213-9609235 CAAATTACAGCCACTGAACTGGG - Intronic
1170202789 20:13762584-13762606 CAAACTAGTGTCCTTGAATTGGG - Intronic
1170611474 20:17917269-17917291 CAAACCACTGCCTCCAAAATTGG + Intergenic
1173024510 20:39295553-39295575 CAAACCACTGCCCTGGGAATAGG - Intergenic
1174029316 20:47608942-47608964 CAACTAAATGCCCCTGAAATTGG - Intronic
1175236284 20:57514498-57514520 CAAAGTACTGGCCCTGATACTGG - Intronic
1179170851 21:38971651-38971673 CAAACCACTGACCCCGAAATTGG - Intergenic
1182056972 22:27366070-27366092 CAAACCACTGCCCCCAAAACTGG - Intergenic
949147257 3:717414-717436 CACACTACTGCCACTGCAGTTGG - Intergenic
949984096 3:9525442-9525464 CAAACTGCTGCCCCCAAAATTGG - Intronic
952349646 3:32521981-32522003 CAAACCACTGCCTCCCAAATTGG + Intergenic
952426989 3:33185562-33185584 CAAACTGCTGTCCCTAGAATTGG - Intronic
955636853 3:61039696-61039718 CAGACTCCTACCCCTCAAATAGG - Intronic
955792624 3:62604291-62604313 CAAACCACTGCCCCCAAAATTGG - Intronic
956234922 3:67058987-67059009 CAAACTACTGCCCACAAAATGGG - Intergenic
957091182 3:75731837-75731859 CAAACCACTGCCCCCAAGATTGG + Intronic
957120547 3:76085630-76085652 CAAACTGTTGCCCCTGAAATTGG + Intronic
957296222 3:78335954-78335976 CAAACCACTACCCCCAAAATTGG - Intergenic
959050390 3:101519196-101519218 CATACTACTGCCTCCAAAATTGG - Intergenic
959304349 3:104641674-104641696 CAAACTACCCCCTCTGACATGGG + Intergenic
963573787 3:147033182-147033204 CAAACTTCTACACCTAAAATTGG + Intergenic
965114887 3:164476781-164476803 CAAACTGCTGCCCCTAAAATAGG - Intergenic
965193830 3:165568111-165568133 CAAACTACTGCCCCCAAATCTGG + Intergenic
965849183 3:173001732-173001754 CAAACCACTGCCCCCAAAATTGG - Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
971577272 4:28291662-28291684 CAAACCGCTGCCCTTAAAATTGG + Intergenic
973785433 4:54328331-54328353 CCAACTACTATTCCTGAAATGGG - Intergenic
974189543 4:58486796-58486818 CAAACTACTGCCCTCAAAATTGG - Intergenic
974854078 4:67438624-67438646 CAAACCACTGCACCTCAAGTTGG + Intergenic
977952422 4:102987859-102987881 CAAACTGCTGCCCAAAAAATAGG - Intronic
978447008 4:108789375-108789397 CAAACTGGTGCCCCTGCAAGTGG - Intergenic
978872227 4:113593318-113593340 CAAACTGCTGCCCCTAAAATTGG + Intronic
978938259 4:114405305-114405327 CAAACCACTGCCCCAAAAACTGG - Intergenic
979647431 4:123087785-123087807 CAAATCACTGCCCCCAAAATTGG - Intronic
980770247 4:137363056-137363078 CAAACCACTGCCCCCAAGATTGG + Intergenic
982873784 4:160618518-160618540 AAAACTACTGTGCCTGAAAATGG + Intergenic
983003864 4:162457692-162457714 CATGCTATTGCCCCTGAAGTGGG - Intergenic
984050341 4:174857556-174857578 CAAACCAATGCCCCCCAAATTGG - Intronic
984334690 4:178375793-178375815 CAAATCACTGCCCCTTAAACTGG - Intergenic
984648963 4:182249245-182249267 AAAAGCACTGGCCCTGAAATCGG - Intronic
984753696 4:183304170-183304192 CAAACTACTGCCCCCAGAATTGG + Intronic
986595872 5:9421084-9421106 CAAAGAAATGGCCCTGAAATAGG - Intronic
986644413 5:9902596-9902618 CAAACTTCTGCCCCACAAACTGG + Intergenic
988820045 5:34874114-34874136 CAAACCAGTGCCCCACAAATTGG + Intronic
989367280 5:40670782-40670804 TAAGCTACTGCACCTGACATGGG - Intergenic
989471442 5:41823554-41823576 CAAACCACTGCCACCCAAATTGG - Intronic
990201959 5:53385989-53386011 CAAACCACTGCCCCCAAAATTGG + Intergenic
990441098 5:55846147-55846169 CAAACCACTGTCCCCAAAATTGG - Intergenic
991150138 5:63358151-63358173 CAAACCACTGCCCCCAGAATTGG - Intergenic
991542465 5:67745308-67745330 CAAACCACTGCCCCCAAAATTGG + Intergenic
992033325 5:72746303-72746325 CAAATTGCTGCCCCCCAAATTGG + Intergenic
992488555 5:77218975-77218997 CAAACTGCTGCCACAGACATGGG + Intronic
992823126 5:80518591-80518613 CACTCTTCTGCCCCTGAATTGGG - Intronic
992921911 5:81533660-81533682 CAAACCACTGCCCCCAAAACTGG + Intronic
994717980 5:103346725-103346747 CAAACCGCTGCCCCAAAAATTGG - Intergenic
994858224 5:105153418-105153440 CAAATTACTGCCCCCAAAATTGG - Intergenic
994884777 5:105546212-105546234 CAAACTGCTGCCCAAGAATTGGG + Intergenic
994915356 5:105969443-105969465 CAAACTATTGCCCCCAAAATTGG - Intergenic
995145342 5:108782165-108782187 CAAACCACTGCCCCACAAACTGG - Intronic
995251101 5:109994202-109994224 CATCCTGCTGCCCCAGAAATGGG + Intergenic
995322407 5:110851347-110851369 CAAAATACTTCCCCCAAAATTGG - Intergenic
996985412 5:129556578-129556600 CAATCAACTGACCTTGAAATAGG + Intronic
997759703 5:136433262-136433284 CAATCTACTACACCTGACATGGG - Intergenic
1001499099 5:172214967-172214989 CAAACCACTGCCCCCGAAATAGG + Intronic
1002164433 5:177335788-177335810 CAGACTACAGGCCCTGGAATGGG + Intronic
1003235063 6:4288202-4288224 CAAAGCACAGCCCCTGACATTGG + Intergenic
1003854233 6:10256031-10256053 TAAACTGCTGCCCCTAAAATTGG + Intergenic
1004952493 6:20689437-20689459 CAAATCACTGCCCCTAATATTGG - Intronic
1005473426 6:26184274-26184296 GAAACTCCTGCAGCTGAAATAGG + Intergenic
1005625560 6:27659101-27659123 CAAACCACTGCCCCCAAAATTGG + Intergenic
1007322002 6:41034224-41034246 CACACCCCTGCCCCTGAAAGAGG + Intronic
1009960427 6:70514582-70514604 CAAACTCCTGTCCCCAAAATTGG + Intronic
1010079631 6:71844907-71844929 CAAACTGCTGCCCCACAAATTGG - Intergenic
1013720341 6:113018820-113018842 CAAACCACTGCCCACAAAATTGG + Intergenic
1013864099 6:114673623-114673645 CAAATTACTGCCCCTAAAATTGG - Intergenic
1014771565 6:125463521-125463543 AAAACTTCTGTCCCTGAAATTGG - Intergenic
1015339123 6:132077612-132077634 TAACCTACTGCCACTGAAATAGG - Intergenic
1016628833 6:146203553-146203575 CATAAAACTGTCCCTGAAATAGG - Intronic
1018184259 6:161252172-161252194 AAAACTACGGCCTCTGACATGGG + Intronic
1018736361 6:166689715-166689737 CAAACTTTTGCCTATGAAATAGG - Intronic
1019897124 7:3991243-3991265 GAAACAACTGCCCGTGAGATGGG + Intronic
1023212058 7:37816610-37816632 CAAACTGCTGCTCCCCAAATTGG - Intronic
1024964867 7:55015334-55015356 CAAACCACTGCCCCCCAAATTGG - Intergenic
1029036087 7:97523508-97523530 CAAACTACTGCCCCTAAAACTGG - Intergenic
1030192982 7:106828069-106828091 CAAACTAATCCCTCTGGAATTGG - Intergenic
1031113324 7:117638175-117638197 CAAACCACTGCCCCCCAAAATGG - Intronic
1032172131 7:129593602-129593624 CAAACTACTGCCCCCAACACTGG - Intergenic
1033468436 7:141620498-141620520 CAAACTGCTGCCCCCAAGATTGG + Intronic
1034942778 7:155242333-155242355 AAAACTGCTGATCCTGAAATAGG - Intergenic
1037642483 8:20759705-20759727 CAAACTTCTGCCTCTTAATTGGG + Intergenic
1037770994 8:21799746-21799768 CAAGCTAATCCCCCTGAAGTGGG + Intronic
1040449164 8:47526857-47526879 CAAACAGCTGCCCCCCAAATTGG + Intronic
1040843151 8:51805852-51805874 CAACCTAATGACCCTGGAATAGG + Intronic
1040972085 8:53146319-53146341 CAAGCTACTTCACCTGAAATTGG + Intergenic
1041892672 8:62888533-62888555 CAAACCACTGCTCCCAAAATTGG - Intronic
1042778297 8:72460350-72460372 CAAACCACTGCCCCCAAAGTTGG - Intergenic
1044038815 8:87339457-87339479 AAAACCACTGCCCCAGAAATTGG - Intronic
1044746711 8:95377977-95377999 AAAACTACATCCCCTGAAGTGGG + Intergenic
1046854491 8:119015732-119015754 CAAACTACTGCCCCTGAAATTGG - Intronic
1047589437 8:126311507-126311529 CAAACTACTCAGGCTGAAATGGG + Intergenic
1047672998 8:127169442-127169464 GAAACTACTGCCCCCAGAATTGG - Intergenic
1048726521 8:137391630-137391652 CATACTACTGACCCTTGAATAGG - Intergenic
1050227243 9:3473867-3473889 CAAAATACTGCTGTTGAAATAGG + Intronic
1051981424 9:23024089-23024111 CAATCTATTGCCCCTCAAATTGG - Intergenic
1052081096 9:24206364-24206386 CACACCACTGCCCCCAAAATTGG - Intergenic
1059277011 9:113106135-113106157 CCAACGACTGCCTCAGAAATGGG - Intergenic
1059279240 9:113118416-113118438 CCAACGACTGCCTCAGAAATGGG + Intergenic
1059381253 9:113927938-113927960 CAAACCACTGCCCCTAAAAGTGG - Intronic
1060322507 9:122576852-122576874 CAACCCACTGCCCCCCAAATTGG - Intergenic
1061151194 9:128829279-128829301 CGAACTGCTGCCCCAGAAAGCGG + Intronic
1061489728 9:130938439-130938461 CAAACTCCAGCCCCCGCAATGGG + Intronic
1062086605 9:134652446-134652468 CATCCTCCTGCCCCTGAAACAGG + Intronic
1062477439 9:136735786-136735808 CATGCCACTGCCTCTGAAATGGG + Intergenic
1185721699 X:2387756-2387778 TAAACTTCTGCCCTTGGAATGGG - Intronic
1187178219 X:16916214-16916236 TCAACCACAGCCCCTGAAATGGG - Intergenic
1192005716 X:67209918-67209940 CATATTACTGTCCCTGAACTAGG - Intergenic
1192188512 X:68975152-68975174 CAAACCACTGCCCCCAAAATTGG - Intergenic
1193668109 X:84349204-84349226 CAAACCACTGACCCCAAAATTGG - Intronic
1193854370 X:86580760-86580782 CTCATTAGTGCCCCTGAAATAGG + Intronic
1194410506 X:93552076-93552098 CAAAATACTTCCACTGAATTTGG - Intergenic
1194936580 X:99957059-99957081 CAAACTAGTGAGCCTGCAATAGG + Intergenic
1195587820 X:106585991-106586013 GTAACTGCTGCCACTGAAATAGG + Intergenic
1195609128 X:106844933-106844955 CAAACTACTGAAACTAAAATGGG - Intronic
1195897384 X:109760626-109760648 CAAACTGCTGCCCCCAGAATTGG + Intergenic
1196419062 X:115504359-115504381 GAAACCACTGCCCCTGAACTTGG - Intergenic
1196480906 X:116146297-116146319 CAAACCACTACCCCCAAAATTGG - Intergenic
1197404615 X:126034728-126034750 CAAACCACTGTCCCCAAAATTGG - Intergenic
1197813396 X:130471039-130471061 AAAACTACTGCCCCTGAAACAGG - Intergenic
1200095071 X:153654815-153654837 CAAAATGCTGCCCCCAAAATTGG - Intergenic
1200293131 X:154890256-154890278 CAAACTATAGCCCCAGAATTTGG - Intronic
1200339978 X:155385988-155386010 CAAACTATAGCCCCAGAATTTGG - Intergenic
1200346492 X:155454700-155454722 CAAACTATAGCCCCAGAATTTGG + Intergenic