ID: 1046856729

View in Genome Browser
Species Human (GRCh38)
Location 8:119040753-119040775
Sequence TCCCTTCTGTTGATAGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046856729_1046856735 6 Left 1046856729 8:119040753-119040775 CCACCAGCTATCAACAGAAGGGA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1046856735 8:119040782-119040804 AGAGCTGTGGCCATTGACAGGGG No data
1046856729_1046856736 10 Left 1046856729 8:119040753-119040775 CCACCAGCTATCAACAGAAGGGA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1046856736 8:119040786-119040808 CTGTGGCCATTGACAGGGGAAGG No data
1046856729_1046856732 -7 Left 1046856729 8:119040753-119040775 CCACCAGCTATCAACAGAAGGGA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1046856732 8:119040769-119040791 GAAGGGAAGGATCAGAGCTGTGG No data
1046856729_1046856733 4 Left 1046856729 8:119040753-119040775 CCACCAGCTATCAACAGAAGGGA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1046856733 8:119040780-119040802 TCAGAGCTGTGGCCATTGACAGG No data
1046856729_1046856734 5 Left 1046856729 8:119040753-119040775 CCACCAGCTATCAACAGAAGGGA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1046856734 8:119040781-119040803 CAGAGCTGTGGCCATTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046856729 Original CRISPR TCCCTTCTGTTGATAGCTGG TGG (reversed) Intronic
901705784 1:11071955-11071977 TCCCTTCTGCTGAGGGATGGTGG - Intronic
908523645 1:64967341-64967363 TCCCTTCAGGTGAGAGATGGTGG - Intergenic
912641820 1:111353519-111353541 TACCAGCTGTTGACAGCTGGTGG + Intergenic
913681351 1:121188686-121188708 TCCCCTCTAATGATTGCTGGGGG + Intronic
914033182 1:143976327-143976349 TCCCCTCTAATGATTGCTGGGGG + Intergenic
914156264 1:145091639-145091661 TCCCCTCTAATGATTGCTGGGGG - Intronic
920468667 1:206207212-206207234 TCCCCTCTAATGATTGCTGGGGG + Intronic
923830793 1:237554165-237554187 TCCCTTCTGTTCTTAGTTTGTGG + Intronic
1067239024 10:44474897-44474919 TGCCTTCTGTTGCTGGGTGGGGG - Intergenic
1068696269 10:59971087-59971109 TCCCTTCTGTAAATAGCAGTGGG + Intergenic
1074143362 10:110696410-110696432 TCCCCTTTGCTGATTGCTGGAGG + Intronic
1077488184 11:2848588-2848610 TCCCTCCTGCTGGAAGCTGGGGG - Exonic
1078254345 11:9644714-9644736 TCCCTTCTGCTGATGACTTGAGG + Intergenic
1080252450 11:30249392-30249414 TGCCTTCTGTTGTTAGGTAGAGG - Intergenic
1080418681 11:32091738-32091760 TCCCTTCTGATGCAACCTGGGGG - Intronic
1081176858 11:39938069-39938091 TCCCTTCTGTTGGTGGTGGGGGG + Intergenic
1086055498 11:82641720-82641742 TCTCTTCTGATAAAAGCTGGTGG - Intergenic
1086055509 11:82641822-82641844 TCCCCTCTGCTGATTGCTAGTGG - Intergenic
1086348688 11:85923547-85923569 TCCCATCTGTTGATAGCCCCAGG + Intergenic
1090877026 11:130799352-130799374 TCCCTTCTTTTTATTGTTGGTGG + Intergenic
1092517813 12:9234077-9234099 TCCCTTCTTTTGGTCACTGGTGG + Intergenic
1094067947 12:26381218-26381240 TCCCTTCTTTTGAAAACTGAAGG - Intronic
1096356805 12:50948432-50948454 ACACTTCTGTAGATTGCTGGTGG + Intergenic
1100467715 12:94862005-94862027 TCCCTTCTGCTGAAGGCAGGAGG + Intergenic
1103858114 12:123988958-123988980 GCCCTTGTCTTGATAGCTGCTGG + Intronic
1104982336 12:132579059-132579081 TCCCTCCTCTGGATACCTGGTGG + Intronic
1107697037 13:43010591-43010613 TCCCTTCTGCTCCCAGCTGGCGG - Intergenic
1107921285 13:45210980-45211002 TCTCTTTTGAGGATAGCTGGAGG + Intronic
1108104167 13:46990770-46990792 TCTCTGCAGTTGATAGCTGATGG + Intergenic
1108168658 13:47718831-47718853 CCCCCTCTTTGGATAGCTGGGGG - Intergenic
1113772274 13:112917783-112917805 TCCCTTCTCTTGTTTGCTGCGGG + Intronic
1115874462 14:37844882-37844904 TCCCTTCTGTCATTAGCTGAAGG - Intronic
1117643937 14:57830994-57831016 TCCCTGCTCTTGAATGCTGGTGG + Intronic
1118476026 14:66117933-66117955 TCCATTCTGTTGACAGATAGAGG - Intergenic
1123575299 15:21659971-21659993 TCCCTTCTCTTGCTAGCTTTGGG + Intergenic
1123611917 15:22102441-22102463 TCCCTTCTCTTGCTAGCTTTGGG + Intergenic
1126405963 15:48322788-48322810 TCACTTCTGTTGATTACTGGGGG + Intergenic
1202984167 15_KI270727v1_random:394215-394237 TCCCTTCTCTTGCTAGCTTTGGG + Intergenic
1132682841 16:1150672-1150694 TCCCTTCTGCCGACATCTGGAGG + Intergenic
1136318612 16:29468129-29468151 TGCCTTCTGTTGGTTGCTGAGGG + Intergenic
1136433184 16:30207475-30207497 TGCCTTCTGTTGGTTGCTGAGGG + Intronic
1142144864 16:88488691-88488713 TCCCCTCTGCTGGCAGCTGGGGG - Intronic
1142697246 17:1640308-1640330 TCCCTCCTGTTGAAGACTGGGGG - Intronic
1146401801 17:32505411-32505433 TCCTTTCTTCTGATACCTGGAGG - Intronic
1150162435 17:62909927-62909949 TCTCTTCTGTGTATAGATGGTGG - Intergenic
1151261273 17:72917873-72917895 TTCCTGCTGTAGGTAGCTGGTGG - Intronic
1153676813 18:7463258-7463280 TCCCTTCTTTTGATAGATTATGG - Intergenic
1153697344 18:7657375-7657397 TCCTTTCTGATGATAGATTGAGG + Intronic
1154406840 18:14099713-14099735 TCCCTTGTTGTTATAGCTGGAGG - Intronic
1154413671 18:14159794-14159816 TTCCTTCTGTTCCTAGCTTGAGG - Intergenic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1158152363 18:54387360-54387382 TCCCTCCTGGTGTTAGCTGGGGG - Intergenic
1158607297 18:58907078-58907100 TCTCCTCTGTAGATAGGTGGAGG - Intronic
1161388427 19:4008855-4008877 TCTCTTTTGTTGATCTCTGGAGG + Intronic
1163862196 19:19748340-19748362 TCCCTTCTGATGAGAGCAGAAGG - Intergenic
1165647470 19:37454624-37454646 TTCCTTGTGGTGTTAGCTGGGGG - Intronic
925004296 2:429146-429168 TCCCTACTGTTGAGGCCTGGTGG + Intergenic
926014828 2:9441567-9441589 AACCTTCTGTTGGTAGCTAGAGG - Intronic
929296276 2:40250957-40250979 CGCCTTCATTTGATAGCTGGTGG - Intronic
931476245 2:62590562-62590584 TTCCTTCTGTGGATAACTGAGGG + Intergenic
933119874 2:78523121-78523143 GGCCTTCTGGTGAGAGCTGGGGG + Intergenic
935942229 2:108252659-108252681 TTCCTCCTGTTCTTAGCTGGTGG + Intronic
938233471 2:129681414-129681436 TGCCTTCTGTTGCTAGGTTGGGG - Intergenic
942393540 2:175522211-175522233 TCCCCGCTGGTGTTAGCTGGAGG + Intergenic
943169800 2:184384346-184384368 TCCCTTCAGCTGTTAGCTGTAGG - Intergenic
946662324 2:222014834-222014856 TCCCTACTGTTGATAGTTCTTGG - Intergenic
948474903 2:238211135-238211157 TTCCTCCTGTGGATGGCTGGGGG + Intergenic
948904057 2:240969479-240969501 ACCCTTCTGGTGACAGCTGCTGG + Intronic
1170075037 20:12410129-12410151 GCCATTCTGTTAAGAGCTGGGGG + Intergenic
1175047911 20:56124815-56124837 TCCTTTCTGTTGCTGACTGGGGG + Intergenic
1175313885 20:58032151-58032173 TGCTTCCTGTTGATGGCTGGGGG - Intergenic
1176277169 20:64279023-64279045 TCCAAAGTGTTGATAGCTGGAGG + Intronic
1184883869 22:47330056-47330078 TCCCTTTTTTTGGTTGCTGGGGG + Intergenic
1185179494 22:49350882-49350904 GCCCATCTGTCGACAGCTGGAGG + Intergenic
950575226 3:13828212-13828234 TCCCTCCTGTTCGTATCTGGTGG - Intronic
953758191 3:45665837-45665859 TTCCTTCTGTAGATACTTGGGGG + Intronic
953797205 3:45995060-45995082 TCCGTGCTGTTGAAACCTGGCGG - Intronic
954638383 3:52083975-52083997 TCCCTTCTGTTTCGAGCTGAGGG - Intronic
956706604 3:72004487-72004509 TCCCTGCTGTAGGTGGCTGGAGG - Intergenic
956745974 3:72311259-72311281 TCCTTTCTGTGGACAGCTGGTGG - Intergenic
961415399 3:126753060-126753082 GTCCTTCTCTTGGTAGCTGGTGG + Intronic
962013974 3:131421797-131421819 TACATTCAGATGATAGCTGGGGG + Intergenic
963071294 3:141307525-141307547 CCCTTTCTGTTGATAGTTGTAGG + Intergenic
964743370 3:159989449-159989471 TGCCTTCTGTTTGTAGCTGAGGG - Intronic
964996388 3:162887301-162887323 TCTTTGCTGTTCATAGCTGGGGG + Intergenic
965607784 3:170513840-170513862 GCCATTCTGTTGACAGCTTGTGG - Intronic
966986140 3:185182028-185182050 TCGCTTCTGCTGATAGGTGTTGG - Intergenic
968894354 4:3390036-3390058 TCCCTTCTCCTGAACGCTGGTGG + Intronic
970067878 4:12119996-12120018 TCACTTCTGTTGGTACCTGATGG - Intergenic
972063096 4:34906004-34906026 TCTCTTCTGCTTCTAGCTGGAGG + Intergenic
976053317 4:81032467-81032489 TCCCTTGTGTTAACAGCTTGAGG + Intronic
976315792 4:83657493-83657515 GTCCTTCTGTTAGTAGCTGGGGG - Intergenic
980496816 4:133596435-133596457 TCCCTTAGATTGATAGCTGTAGG - Intergenic
984656084 4:182320385-182320407 TGACTTCTGTTGGTTGCTGGTGG + Intronic
989473977 5:41853260-41853282 TCACACCTGTTGATTGCTGGAGG - Intronic
989554301 5:42774362-42774384 TCCCTCATGTTGTTGGCTGGAGG + Intronic
990487069 5:56269670-56269692 TCACTTCTCTAGAGAGCTGGGGG + Intergenic
994008057 5:94864203-94864225 TTCTTTCTGTTCATATCTGGAGG - Intronic
995523377 5:113031484-113031506 TCCCTGCTGTTTTTAGCTGGAGG - Intronic
998079380 5:139261941-139261963 TCCCTGCTGCTGATACCTGATGG - Intronic
1000023857 5:157342191-157342213 TCCCTTCTGTTTGCAGCAGGAGG + Exonic
1003681759 6:8264042-8264064 TGCCTTCTGTTGCTAGGTTGGGG + Intergenic
1004040067 6:11966648-11966670 TCCTTGCTGTTGTCAGCTGGTGG - Intergenic
1006284139 6:33080372-33080394 TCCCTTCTGCTGGTGGCTGGAGG - Intronic
1006996628 6:38267225-38267247 TTTCTTCTGTTAATAGCTGAAGG + Intronic
1008483357 6:52009192-52009214 TCCCTTCAGGTGATAGCCTGGGG - Intronic
1012585580 6:100918251-100918273 TCCTGTCTCTTCATAGCTGGAGG + Intergenic
1012842317 6:104344629-104344651 CCCCTTCTCTTCATTGCTGGAGG - Intergenic
1013189496 6:107790129-107790151 GCGCTTCTGTTTCTAGCTGGAGG + Intronic
1013301028 6:108805067-108805089 TCCCTGCTGCTGTTAGCTGAAGG + Intergenic
1019225369 6:170503698-170503720 TCCCTTCTCATGATAGATGCAGG - Intergenic
1019225403 6:170503842-170503864 TCCCTTCTCCTGATGGCTGCAGG - Intergenic
1019225435 6:170503986-170504008 TCCCTTCTCCTGATGGCTGCAGG - Intergenic
1020952896 7:14703622-14703644 TCCCTTCTGGTGATGGGAGGCGG + Intronic
1022655947 7:32319400-32319422 TCCCTTCTCGTGCTGGCTGGAGG - Intergenic
1025217152 7:57068100-57068122 TTGCTTCTGTTAATAGCTAGGGG + Intergenic
1025628074 7:63241741-63241763 TTGCTTCTGTTAATAGCTAGGGG + Intergenic
1026225231 7:68434513-68434535 TCCTCTCTGCTCATAGCTGGTGG + Intergenic
1033278969 7:139992393-139992415 TCCCCTCTGCTGGGAGCTGGCGG - Intronic
1036680112 8:10865755-10865777 CCCCTTCTTTTGAGAGTTGGAGG - Intergenic
1037822768 8:22143059-22143081 TCCATCCTTATGATAGCTGGTGG - Intergenic
1039462552 8:37757566-37757588 TGCCGTGGGTTGATAGCTGGAGG + Exonic
1046856729 8:119040753-119040775 TCCCTTCTGTTGATAGCTGGTGG - Intronic
1047426546 8:124751733-124751755 TGCCTTCTGTTGCCAGCAGGTGG - Intergenic
1054992599 9:71346759-71346781 TCCCTTCTGTACACAGCTGCTGG - Intronic
1056599731 9:88037109-88037131 TCCCTTCTGTGGACACTTGGGGG + Intergenic
1059381212 9:113927634-113927656 TCCCTTGTGTTGAAAACTAGAGG + Intronic
1060553884 9:124498644-124498666 TGCCTTCTGCTCATGGCTGGAGG - Intronic
1061584575 9:131557630-131557652 TGCCTTCTGCTTATGGCTGGGGG - Intergenic
1062031701 9:134364822-134364844 TCCCTAGTGTTGGTGGCTGGGGG + Intronic
1062033752 9:134373611-134373633 GCCTCTCTGTGGATAGCTGGGGG - Intronic
1186855739 X:13624440-13624462 TCCCTTCTGTTTGTTGCTTGAGG + Intronic
1187208108 X:17202057-17202079 TCCCTTCTGTTGAAACCAAGTGG - Intergenic
1189684488 X:43549773-43549795 TACCTTCAGTTGGTAGCTGTTGG - Intergenic
1191849057 X:65572084-65572106 GCCTTTCTGTTAATATCTGGGGG + Intergenic
1193719868 X:84974270-84974292 CCTCTTCTGGTGGTAGCTGGAGG - Intergenic
1194380322 X:93182031-93182053 CCCTCTCTGCTGATAGCTGGAGG + Intergenic
1196580417 X:117372805-117372827 TCCCTTCTTCTGATAGGTGGAGG + Intergenic
1197885601 X:131214577-131214599 TCCTTTCTTTTTGTAGCTGGTGG - Intergenic
1199684398 X:150253814-150253836 TGGCCTCTGTTGTTAGCTGGTGG + Intergenic
1199827344 X:151513728-151513750 TGCCTTCTGTTGTTAGATTGGGG + Intergenic
1201859012 Y:18574358-18574380 TCCTTTCTCTCCATAGCTGGTGG + Intronic
1201874310 Y:18746023-18746045 TCCTTTCTCTCCATAGCTGGTGG - Intronic