ID: 1046857778

View in Genome Browser
Species Human (GRCh38)
Location 8:119053618-119053640
Sequence CTGGAGACACAAATGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 8, 3: 44, 4: 407}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046857778_1046857790 29 Left 1046857778 8:119053618-119053640 CCATTCTCCATTTGTGTCTCCAG 0: 1
1: 0
2: 8
3: 44
4: 407
Right 1046857790 8:119053670-119053692 CAATTAAAAAAAAAGGTGGGGGG No data
1046857778_1046857786 25 Left 1046857778 8:119053618-119053640 CCATTCTCCATTTGTGTCTCCAG 0: 1
1: 0
2: 8
3: 44
4: 407
Right 1046857786 8:119053666-119053688 TAGGCAATTAAAAAAAAAGGTGG No data
1046857778_1046857785 22 Left 1046857778 8:119053618-119053640 CCATTCTCCATTTGTGTCTCCAG 0: 1
1: 0
2: 8
3: 44
4: 407
Right 1046857785 8:119053663-119053685 TTGTAGGCAATTAAAAAAAAAGG No data
1046857778_1046857782 -2 Left 1046857778 8:119053618-119053640 CCATTCTCCATTTGTGTCTCCAG 0: 1
1: 0
2: 8
3: 44
4: 407
Right 1046857782 8:119053639-119053661 AGATGGTAACAGTGCCTCTCAGG No data
1046857778_1046857787 26 Left 1046857778 8:119053618-119053640 CCATTCTCCATTTGTGTCTCCAG 0: 1
1: 0
2: 8
3: 44
4: 407
Right 1046857787 8:119053667-119053689 AGGCAATTAAAAAAAAAGGTGGG No data
1046857778_1046857789 28 Left 1046857778 8:119053618-119053640 CCATTCTCCATTTGTGTCTCCAG 0: 1
1: 0
2: 8
3: 44
4: 407
Right 1046857789 8:119053669-119053691 GCAATTAAAAAAAAAGGTGGGGG No data
1046857778_1046857788 27 Left 1046857778 8:119053618-119053640 CCATTCTCCATTTGTGTCTCCAG 0: 1
1: 0
2: 8
3: 44
4: 407
Right 1046857788 8:119053668-119053690 GGCAATTAAAAAAAAAGGTGGGG No data
1046857778_1046857791 30 Left 1046857778 8:119053618-119053640 CCATTCTCCATTTGTGTCTCCAG 0: 1
1: 0
2: 8
3: 44
4: 407
Right 1046857791 8:119053671-119053693 AATTAAAAAAAAAGGTGGGGGGG No data
1046857778_1046857783 6 Left 1046857778 8:119053618-119053640 CCATTCTCCATTTGTGTCTCCAG 0: 1
1: 0
2: 8
3: 44
4: 407
Right 1046857783 8:119053647-119053669 ACAGTGCCTCTCAGGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046857778 Original CRISPR CTGGAGACACAAATGGAGAA TGG (reversed) Intronic
901110159 1:6786726-6786748 GTAGACACACAAATGGCGAAAGG - Intronic
902054717 1:13590748-13590770 CTGTAGGCAGAAATAGAGAATGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903552072 1:24164541-24164563 CTGGAGCCAAAAGTAGAGAAGGG - Intronic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904529670 1:31160128-31160150 CTGCAGAGGCAAATGGAGAGAGG + Intergenic
905174660 1:36127914-36127936 CTGGTGACACAAACGGGCAAGGG + Intergenic
905354679 1:37373120-37373142 CTGGGGAGGCAAAGGGAGAAAGG + Intergenic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
907153987 1:52315482-52315504 GTAGAGACAAAAATGTAGAACGG + Intronic
907338409 1:53715865-53715887 CTGCAAACAGAAGTGGAGAATGG + Intronic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
907748930 1:57243688-57243710 CTGGAGACCCAAGTGAGGAAAGG - Intronic
907972575 1:59398014-59398036 CTGGAGAAACAAAATTAGAAGGG - Intronic
909834494 1:80236728-80236750 CTGGAGACTCTACTGGGGAAGGG - Intergenic
910796284 1:91100668-91100690 ATGGAGACTAAAATGGTGAAAGG + Intergenic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
912042210 1:105406115-105406137 CTGGAGACAGGAATTGGGAATGG + Intergenic
912247299 1:107973185-107973207 TTGCACACACAAATGGAAAAAGG + Intergenic
914686394 1:149983555-149983577 TTGGAGAGACAAATTGGGAAAGG + Intronic
915362520 1:155294719-155294741 CTGGTGACCCAAGTGGAGAACGG - Exonic
915931907 1:160065952-160065974 CAGGAGACACAAGAAGAGAAGGG + Intronic
916533587 1:165681696-165681718 CTTAAGACCCAAATGAAGAAAGG + Intronic
916556738 1:165899962-165899984 CTGGAAAAGCAAATGGGGAATGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
920131950 1:203738948-203738970 CTGCTGACACAAATGAAGATTGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063102057 10:2958886-2958908 CTGGTGACAGACATGCAGAATGG + Intergenic
1064754139 10:18559466-18559488 ATGGAGAATCGAATGGAGAATGG + Intronic
1064755478 10:18568919-18568941 ATGGAGAACCAAATGGAGAATGG - Intronic
1066214277 10:33270759-33270781 CTGAAGACACAACAGGAGGAGGG + Exonic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1068082248 10:52333528-52333550 CTGTAGACACAAATATAGCAAGG - Intergenic
1068548167 10:58376052-58376074 CTGGAGACACACATTTAAAAAGG - Intergenic
1070473694 10:76811453-76811475 AAGGAGACAGAAAGGGAGAAGGG - Intergenic
1070653834 10:78257102-78257124 CTGAGGAGACAAGTGGAGAAAGG + Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1072098613 10:92207394-92207416 CTGGAGACAGAAAGACAGAATGG + Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1072914691 10:99530717-99530739 CTGGAAAAAGAAAAGGAGAAAGG - Intergenic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075333844 10:121595294-121595316 CTGAGGACAAAAATGGAGGAGGG + Intronic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078107215 11:8365881-8365903 CTGGAAGGACAAATGGAGAGGGG - Intergenic
1078364175 11:10692981-10693003 CTGGAGACAAAAGAGGAGACAGG + Intronic
1078672157 11:13375121-13375143 CTGGAGATACAAGAGGAGACAGG - Intronic
1078750963 11:14163449-14163471 CTGGAGAAATAAAAGGAGAATGG - Intronic
1080829421 11:35877412-35877434 GTTGAGAGACACATGGAGAAGGG + Intergenic
1080945121 11:36964139-36964161 AAGAAGACACAAAAGGAGAATGG + Intergenic
1081893225 11:46562606-46562628 GTGGAGACACTTATTGAGAAGGG + Intronic
1083367976 11:62153008-62153030 CTGGAGACAACAATGGAAATGGG - Intronic
1083788361 11:64967539-64967561 AGTGAGGCACAAATGGAGAATGG + Intronic
1084006883 11:66327873-66327895 CTGGACACACACATGGGGACAGG - Intergenic
1085539622 11:77254358-77254380 CAGGAGACCCACATAGAGAATGG - Intronic
1085643501 11:78208113-78208135 CAGCAGCCACAAATGGAGACAGG - Intronic
1085738585 11:79060632-79060654 CTGCAGACTCAAATGGAGGCAGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086138815 11:83471528-83471550 CTGGAGAGACTACTGGAGGATGG + Intronic
1086218785 11:84416102-84416124 CTGGAGCACAAAATGGAGAAGGG - Intronic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087239078 11:95755391-95755413 CTGGAGACCCAAAAGCAGAGTGG + Intergenic
1087846938 11:102984081-102984103 CTGGAGACAAAACTTGAGAGTGG + Intergenic
1088161560 11:106877700-106877722 CTGGACACAGGAATGGACAAAGG + Intronic
1089153193 11:116380496-116380518 TTGCAGAGACACATGGAGAAAGG - Intergenic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1090419230 11:126562584-126562606 TAGGAGACACAAAGGGAGAAGGG + Intronic
1091571234 12:1688450-1688472 CTGGAGCCACAACTGGATTATGG + Intergenic
1091971618 12:4792298-4792320 CTGAAGACACAAGTGTAAAAGGG + Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092884553 12:12913763-12913785 CGGGAGAGACACATGAAGAAGGG - Exonic
1093106504 12:15094020-15094042 CTCTAGAGAGAAATGGAGAAGGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093848505 12:24006502-24006524 CCCGAGACACAAAAAGAGAAAGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096419683 12:51446428-51446450 AAGGAGAGACAAATAGAGAAAGG + Intronic
1097033639 12:56107362-56107384 CTAGAGAAGCAAAAGGAGAAAGG + Intronic
1097342120 12:58451047-58451069 CTCTAGACCCAAGTGGAGAATGG + Intergenic
1097885369 12:64723685-64723707 TTTAAGACACAAATGGTGAAAGG + Intronic
1098066620 12:66625136-66625158 CTGGGGACAGATTTGGAGAAAGG + Intronic
1098862343 12:75724197-75724219 ATGGAAACACATATGGGGAAAGG - Intergenic
1099788813 12:87303501-87303523 GTAGAGACACAAATGTAGAAAGG + Intergenic
1101540213 12:105658328-105658350 CTGGGGAGATAAATGGGGAATGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102270290 12:111528616-111528638 TTCGAGACAGAAATGGGGAAGGG + Intronic
1102874227 12:116437214-116437236 CTGGACACACATTAGGAGAAAGG + Intergenic
1103194539 12:119031161-119031183 CTGAAGACTCAATTGGGGAAGGG + Intronic
1103907089 12:124333272-124333294 CTGGAGACCTGGATGGAGAAAGG + Exonic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104177613 12:126348201-126348223 CTGGAGACTCGAAGGGAGGAAGG - Intergenic
1104517163 12:129438301-129438323 CTGAAGACACATGTGCAGAAAGG + Intronic
1106008056 13:25789957-25789979 CTGGCAAAAGAAATGGAGAAAGG + Intronic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106561918 13:30854188-30854210 TTGGAGACACAAATGGTCAGGGG + Intergenic
1106777800 13:33025459-33025481 CTGGGCACACAAAGTGAGAAGGG + Intronic
1108076139 13:46681530-46681552 CAGGAGAGAAAAATGGAGAAAGG - Intronic
1108827331 13:54429656-54429678 CTGGAGACAGAGATAGTGAAAGG - Intergenic
1108830233 13:54468660-54468682 ATGGAGGCATATATGGAGAAAGG + Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1110556088 13:76861013-76861035 CTGGAGGCAAAAATGGAAAATGG + Intergenic
1111983555 13:95042075-95042097 ATGGAGACACTAATGGAGTTGGG + Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113049431 13:106193009-106193031 CAGGAGTTAGAAATGGAGAAAGG + Intergenic
1113420748 13:110169996-110170018 CTTGAGACAGAAATTGAGGAAGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114216102 14:20658835-20658857 CTGGTGACACCAAAGAAGAAAGG + Intergenic
1114367707 14:22047767-22047789 CTAGGCACACACATGGAGAATGG + Intergenic
1114451719 14:22830794-22830816 CTGGAGTCTCATAAGGAGAATGG - Intronic
1115576399 14:34715721-34715743 TTAGAGACAAAAATTGAGAAGGG + Intergenic
1115654450 14:35429941-35429963 CAGGGGAAACAAATAGAGAAGGG + Intergenic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1117243940 14:53864658-53864680 TTGAAGACTCAAAGGGAGAAGGG - Intergenic
1118152589 14:63205423-63205445 CTAGACACACAAATGGTGAAAGG + Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118707373 14:68492772-68492794 CTGGAGAGACAATGGTAGAAGGG - Intronic
1119134916 14:72208581-72208603 CTGGAGATACAAAGGGAAATAGG - Intronic
1122217066 14:100211706-100211728 CTGGACACAGAAGTGGAGACTGG - Intergenic
1122869128 14:104626964-104626986 TTGGAGAAATAACTGGAGAAGGG + Intergenic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1123123944 14:105931092-105931114 ATAGAGACACAAAAGGAGAGAGG + Intronic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123192657 14:106586080-106586102 CAGGTGTCACTAATGGAGAAAGG - Intergenic
1124046675 15:26156818-26156840 CTGGAGCCACAAGTGGAAACTGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1125046432 15:35246456-35246478 AGGGAGACACTAATGGGGAAAGG - Intronic
1125891345 15:43269255-43269277 CTGGTGACTCATTTGGAGAAAGG - Intergenic
1126293208 15:47105993-47106015 CTGGAGACATAAATAGAGGAAGG - Intergenic
1126309162 15:47296253-47296275 TTGGAGAGATGAATGGAGAATGG + Intronic
1127697945 15:61470272-61470294 CAGGAGACACAATAGCAGAAAGG + Intergenic
1128036042 15:64527657-64527679 CTGGAGAAAGGAATGGAGAGAGG - Intronic
1128704352 15:69827829-69827851 CTGGGAACACAAATGGACCAAGG - Intergenic
1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG + Intronic
1130718832 15:86366033-86366055 CTGGGGACACAAAGGGCTAAAGG - Intronic
1130893851 15:88155381-88155403 CTGGAGGCTCTAAGGGAGAATGG - Intronic
1131168940 15:90162867-90162889 CTGGGGAGATAAAGGGAGAAAGG - Intronic
1132437834 15:101824806-101824828 CTGGAGAGACAAATGGAAACTGG - Intergenic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134694367 16:16212250-16212272 CAACAGACAAAAATGGAGAAGGG + Intronic
1134977466 16:18582380-18582402 CAACAGACAAAAATGGAGAAGGG - Intergenic
1135385082 16:22031954-22031976 CTGGTAACAGAAATGGAAAATGG - Intronic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1136108462 16:28048971-28048993 CTGGAGAAAAAAAGGGAGAAGGG + Intronic
1137653020 16:50136544-50136566 CTGGAGAAATAACTGCAGAATGG + Intergenic
1137820732 16:51442788-51442810 ATGGAGAATCAAATAGAGAAGGG + Intergenic
1138278892 16:55757662-55757684 CTGGAGACCCAAATTCAAAAAGG - Intergenic
1138289642 16:55835926-55835948 CTGGAGACCCAAATTCAAAAAGG + Intergenic
1138438406 16:57019984-57020006 GTGCAGGCACAAATGGAGTAGGG + Intronic
1138900117 16:61258660-61258682 CTGTACACACAACCGGAGAAGGG + Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1141306849 16:82872751-82872773 CTGGAGATAGAAATAGGGAATGG + Intronic
1141424211 16:83934920-83934942 CTGGAGACACAACATCAGAAGGG - Intronic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1143762597 17:9115999-9116021 CCGGAGAAACAAATGCAGAGAGG - Intronic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144809961 17:17992742-17992764 CTGGGGAGAAAAAGGGAGAAAGG - Intronic
1145836903 17:27961245-27961267 CTGGGAAGAAAAATGGAGAAAGG - Intergenic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1148823689 17:50376691-50376713 CAGGAGAGAGAAATGGAGAGAGG + Intronic
1149037483 17:52151430-52151452 TTGTAGATACAAGTGGAGAAGGG - Intronic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1149559617 17:57599245-57599267 CCCGAGACACAGATGGGGAAAGG + Intronic
1151043916 17:70896836-70896858 ATGGAGAGTAAAATGGAGAACGG + Intergenic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152890654 17:82879941-82879963 CTGGAGACACCCAAGGAGACAGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153162143 18:2218659-2218681 CTGGAGAAGCAAATGCTGAATGG - Intergenic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1154062697 18:11077950-11077972 CTGGAAACAGCAATGGAAAAAGG + Intronic
1155700469 18:28736882-28736904 CTGGAGACACTAATATGGAAAGG + Intergenic
1155724569 18:29063758-29063780 ATGCAGACATAGATGGAGAAGGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1158585569 18:58730727-58730749 CTGGTGGCACAAATGTAAAATGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159363416 18:67434540-67434562 ATTGAGACACCCATGGAGAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163228854 19:15985007-15985029 CTAGAGACCCATTTGGAGAAAGG + Intergenic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164944595 19:32282757-32282779 CTGGAGACTCAAAAGGGGAGAGG - Intergenic
1165277471 19:34767418-34767440 ATGGAGAAACAAATGGAGTATGG + Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167676452 19:50889386-50889408 GAGGAGAGACAAATGGCGAAAGG + Intergenic
1168269946 19:55244364-55244386 CTGGAGAAACACATGGACATGGG + Intronic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
1168443042 19:56388337-56388359 ATGAAGAAACAAATGGTGAAAGG + Intronic
1168456663 19:56516791-56516813 CTGAAGACACAAACTGAAAATGG + Intronic
1168555944 19:57339985-57340007 ATGTAGACACAAATGGATTAGGG + Intergenic
1168697050 19:58409378-58409400 CTGGAGACGCATGTGCAGAACGG + Intronic
925085474 2:1104574-1104596 GGGAAAACACAAATGGAGAAAGG + Intronic
925130632 2:1491871-1491893 CTGGAGACAGAAAACGAGAGTGG + Intronic
925779822 2:7371979-7372001 CTGGGAAGACAAATGGAGACTGG + Intergenic
927026308 2:19072470-19072492 CTGATGACACATCTGGAGAAAGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927535019 2:23849079-23849101 CAGCAGACACAAATAGAAAATGG + Intronic
927758424 2:25727653-25727675 CTGGGGACAAAAAAAGAGAAGGG + Intergenic
928380521 2:30813958-30813980 CTGAAGACACAAAAAGAGACTGG + Intronic
929524489 2:42687868-42687890 CTGGAGTCAGAGATGAAGAAGGG - Intronic
929917878 2:46151326-46151348 CTGGACAGAGAAAGGGAGAAGGG - Intronic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
934673725 2:96234411-96234433 CAGGAGACAGGAATGGAGGAGGG - Intergenic
934796930 2:97109274-97109296 CTGGTGACTCAAAGAGAGAAAGG - Intergenic
934836483 2:97594157-97594179 CTGGTGACTCAAAGAGAGAAAGG + Intergenic
935053709 2:99546441-99546463 CTAGAGAGAAAAATGCAGAAAGG - Intronic
935076345 2:99748220-99748242 CAGGAGACACAAAAGTGGAAAGG - Intronic
935426627 2:102925722-102925744 CTGGGGAAAAAAAAGGAGAAAGG + Intergenic
936545321 2:113387303-113387325 CTGGTGACTCAAAGAGAGAAAGG - Intergenic
936823061 2:116546683-116546705 GTGAAGACACAAATGCAGAGAGG + Intergenic
939753957 2:146086041-146086063 CAGGAGCCAAAAATAGAGAAGGG - Intergenic
939763555 2:146216108-146216130 CTAGAATCAGAAATGGAGAATGG + Intergenic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942380293 2:175384165-175384187 TGGAAGACAGAAATGGAGAAGGG + Intergenic
942440876 2:176035166-176035188 CTGGTGAAACAAATGGCCAATGG - Intergenic
945001706 2:205358097-205358119 CAGGAGACAAAAATTAAGAATGG - Intronic
945067528 2:205959808-205959830 CTGGAGGCAAAAATAGAGAGTGG + Intergenic
945686267 2:212974273-212974295 CTGGTGACAAGAAGGGAGAATGG + Intergenic
945978529 2:216289538-216289560 ATGGAGAAACAACTGGAGACTGG - Intronic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
1170281661 20:14655959-14655981 CTGGAAATAGAAATGAAGAAAGG + Intronic
1170956966 20:20990329-20990351 CTAGAACCAAAAATGGAGAAAGG - Intergenic
1171191907 20:23164797-23164819 CTGGACACAGAAGTGGAAAATGG - Intergenic
1171487955 20:25497427-25497449 CTGCAGATAGAACTGGAGAAAGG - Intronic
1171536162 20:25892577-25892599 CTGGAGACAGAAATAGAGGAAGG + Intergenic
1171804936 20:29668581-29668603 CTGGAGACATAAATAGAGGAAGG - Intergenic
1171839123 20:30187847-30187869 CTGGAGACATAAATAGAGGAAGG + Intergenic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1175209907 20:57347422-57347444 CTAGAAACAAAAAGGGAGAACGG - Intergenic
1175253086 20:57621519-57621541 CAGGAAACACAATTGGGGAATGG - Intergenic
1177169031 21:17635445-17635467 CTGGTGACATAAATGATGAATGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1178309153 21:31515226-31515248 CTAGAGAGACAAAAGAAGAAGGG - Intronic
1178396623 21:32248934-32248956 CTGGGGAGAAAAATGAAGAAAGG + Intergenic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1178686803 21:34718274-34718296 CTTGAAACCTAAATGGAGAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179486273 21:41712593-41712615 CTGGAGAGACAAAGGGAGGTGGG - Intergenic
1180038992 21:45266129-45266151 CTGGAGAAACCCCTGGAGAAGGG - Intronic
1180198807 21:46212815-46212837 CTGCAGACAGACATCGAGAACGG + Intronic
1180789027 22:18564073-18564095 TTGGACACTGAAATGGAGAATGG + Intergenic
1181140004 22:20797403-20797425 CTGGGGACACTCCTGGAGAAAGG + Intronic
1181232708 22:21431247-21431269 TTGGACACTGAAATGGAGAATGG - Intronic
1181245943 22:21503609-21503631 TTGGACACTGAAATGGAGAATGG + Intergenic
1181479124 22:23186577-23186599 TCAGAGACACAGATGGAGAATGG - Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1182266222 22:29117706-29117728 CATGAGGAACAAATGGAGAAAGG + Intronic
1182640704 22:31764745-31764767 ATGGAGAGAAAAAGGGAGAAGGG - Intronic
1182760500 22:32718734-32718756 CTTTAGACACAAATGAAGACAGG + Intronic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
1184173892 22:42775120-42775142 ATGGAGAAACAACTGGAGACTGG + Intergenic
1185102623 22:48849826-48849848 GTGGGGACAGAAAGGGAGAAAGG + Intronic
949139089 3:610431-610453 CAGGAATCAGAAATGGAGAAAGG - Intergenic
952373328 3:32744058-32744080 ATGTGGACACAAATGGTGAAGGG + Intronic
952576353 3:34778705-34778727 GTGGGGAAATAAATGGAGAAAGG + Intergenic
952833780 3:37587533-37587555 ATGGAGAGATAAATGGTGAATGG - Intronic
952916931 3:38253503-38253525 CTGGAGAGAGCAATGAAGAAGGG - Exonic
953551465 3:43906896-43906918 CTAGAGTGACAAAAGGAGAAAGG + Intergenic
953556816 3:43952491-43952513 CTGGAGACACCAATTCTGAATGG - Intergenic
953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG + Intergenic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954749591 3:52806080-52806102 CTGCAGATACAAAGGGAGAGAGG - Intronic
955608808 3:60735329-60735351 CTGGAGTCAGAACTGGAGAAGGG - Intronic
956066928 3:65406537-65406559 CGGGAGACCCAAATGCAGAGGGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956283970 3:67589360-67589382 CTGGAGATATAACTGGAGTAAGG - Intronic
958491460 3:94779469-94779491 GTGTAGCCACAAATGGAGGATGG + Intergenic
958603722 3:96331750-96331772 CTGGAGACACGAGTGGAAAAGGG + Intergenic
959749356 3:109814778-109814800 CTGGCACCACAAAGGGAGAAAGG - Intergenic
960553276 3:119000705-119000727 TTGAAGACTCAAAGGGAGAAGGG + Intronic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961334366 3:126161449-126161471 CAGGAGTCACAAAAGGAGCAAGG + Intronic
961465672 3:127079605-127079627 CAGGAGACATAGATGGAGAGTGG + Intergenic
962228790 3:133641264-133641286 CAGGAGACCCAAATGTAAAAAGG - Intronic
962842035 3:139242698-139242720 AAGGACACACAAATGGACAATGG - Intronic
963380407 3:144522853-144522875 CTGAAAACAAAAATGGTGAAAGG + Intergenic
963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG + Intergenic
964346966 3:155763684-155763706 CTGGAGAGAAATATGGAAAAAGG - Exonic
965420332 3:168449945-168449967 GTGGGGAAACAAAGGGAGAATGG - Intergenic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
966294601 3:178404702-178404724 CTGGAACCACAAAAAGAGAAAGG - Intergenic
966444715 3:179988774-179988796 GTGGAGACACAAATGTAGTTAGG + Intronic
966610393 3:181862336-181862358 CTGGAGTGAAAAATGTAGAAAGG - Intergenic
966625294 3:182009239-182009261 CTGGAAACATAAAAGGAAAAAGG + Intergenic
966946683 3:184781755-184781777 CAAGAGACACAACTGGAAAATGG + Intergenic
967052227 3:185795343-185795365 CTGGAGAAACAAATGTGGTATGG - Intronic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
967182526 3:186918846-186918868 CTACATACACAAAAGGAGAAAGG - Intergenic
968086480 3:195876185-195876207 TTGGAGACACAAATGATGACTGG - Intronic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
970672911 4:18416717-18416739 CTTGAGACACAAACATAGAATGG - Intergenic
970815377 4:20150094-20150116 GTGGGGACACAAAAGGAGGAAGG - Intergenic
972703076 4:41513450-41513472 CCGGATACACAAATGGGGCAAGG - Intronic
972763214 4:42127548-42127570 CTTGAGAAACAAATGGAGACAGG + Intronic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
974717761 4:65693079-65693101 CTGGTCACACAAATGGACTACGG + Intergenic
975619398 4:76280870-76280892 CAGGAGGCAGAAATGAAGAAAGG - Intronic
975755548 4:77568103-77568125 CTGGTAACACAAAGGGACAATGG + Intronic
977247692 4:94652893-94652915 CAAGAGTCACAAAAGGAGAAAGG - Intronic
978284612 4:107061521-107061543 CTTGAGACAGAAAGGGAAAACGG - Intronic
979336936 4:119474203-119474225 CTGGTTACACAAATGGCCAAAGG - Intergenic
980977933 4:139628890-139628912 CTTGAGAGAGAAAGGGAGAAGGG - Intergenic
981058714 4:140395945-140395967 ATGAAGACACGGATGGAGAATGG - Exonic
981884965 4:149663920-149663942 CTGGGGGAAGAAATGGAGAAGGG - Intergenic
982376403 4:154695798-154695820 CTGGTTACAGAAATGGGGAATGG - Intronic
982425368 4:155252301-155252323 CTGGTGATAGAAATGGAAAACGG + Intergenic
983081580 4:163391806-163391828 CTGTACACACAAATGTAGATAGG + Intergenic
984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG + Intergenic
984950376 4:185003585-185003607 GTGCAGACACAAGTGGAGACGGG + Intergenic
986816144 5:11414084-11414106 AGAGAGACAAAAATGGAGAAGGG + Intronic
988400448 5:30754130-30754152 CTGCAGACAGAAGTGGATAAGGG + Intergenic
988595366 5:32585781-32585803 GTGGAGTCAGAAACGGAGAAGGG - Intronic
989383139 5:40828896-40828918 TTGGAGACAGAAGTGGAGAGAGG - Exonic
990136177 5:52646032-52646054 CAGGAGAAAGAAAGGGAGAAGGG - Intergenic
990311714 5:54546342-54546364 ATGAAGACATAAATGGAAAATGG - Intronic
990817451 5:59802000-59802022 CAGGAGATACAAATAAAGAAGGG + Intronic
991656312 5:68907375-68907397 TTGGAGAAAAAAATAGAGAATGG - Intergenic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
992371059 5:76144632-76144654 GAGGAGATACAAAAGGAGAAGGG + Intronic
994591223 5:101775237-101775259 ATGGAGGGACAAATGGAGAGAGG - Intergenic
995729573 5:115223549-115223571 CTGGAGACACTGTTGGCGAAAGG + Intronic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
997362333 5:133303063-133303085 CAGGAGGCACAAAAGGACAAAGG - Intronic
998534373 5:142915770-142915792 CTGGGGTCAAAAAAGGAGAAAGG - Intronic
998556402 5:143128755-143128777 CTCGAGACACAAATGTACCAGGG - Intronic
999233078 5:150073720-150073742 ATGGAGGCACAAATGGGGATAGG - Intronic
999345390 5:150814321-150814343 CTGGACACACAAAAAGAAAATGG + Intergenic
1000778140 5:165444517-165444539 CTGGAGAAACTAATTTAGAAAGG - Intergenic
1001285845 5:170423423-170423445 TTGGGGAGACAAATGGAGAGAGG - Intronic
1001769626 5:174283476-174283498 CTGGAGCCAGAAGGGGAGAATGG + Intergenic
1002078837 5:176725956-176725978 CTAGAGACAAAAAGGGAGCATGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004428304 6:15521577-15521599 CTGTACACACAACCGGAGAAGGG - Exonic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1006303543 6:33206580-33206602 GTGGAGACACAAATGGGCTAGGG - Intronic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1010155028 6:72782644-72782666 TAGGAGACACAAAGGGACAAGGG - Intronic
1011000732 6:82585176-82585198 CTGAAGACAAAAATAGAGAAAGG + Intergenic
1011005942 6:82645747-82645769 CTTGAGACACAATTGGACCAGGG - Intergenic
1011308188 6:85952511-85952533 CGGGAGACACAGAAGGGGAAGGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012132567 6:95515775-95515797 TTGGACACACAAATATAGAAAGG + Intergenic
1012642832 6:101642387-101642409 ATGGAAAGAGAAATGGAGAATGG - Intronic
1012729698 6:102866682-102866704 TTGGAGACTCAAAAGGGGAAAGG + Intergenic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1013427291 6:110024308-110024330 CAAGAGACATAAATGAAGAAGGG + Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1014520503 6:122436852-122436874 AAGAAGACACAAATAGAGAATGG + Intergenic
1016063854 6:139658510-139658532 CTGGCCATACAATTGGAGAAAGG + Intergenic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1018933448 6:168257694-168257716 CATGAGAGACAAATGGGGAATGG - Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021249526 7:18306883-18306905 TTGGAAACAGACATGGAGAATGG - Intronic
1021290709 7:18840909-18840931 CTTGTGACAAAAATGTAGAAAGG + Intronic
1021292410 7:18863024-18863046 CTCCAGACACAAAAGCAGAATGG - Intronic
1021950252 7:25767337-25767359 CTGGAGCCACAAAACCAGAAGGG + Intergenic
1022362921 7:29680123-29680145 CTAGAGACTCAACTGGGGAAAGG - Intergenic
1022628026 7:32058223-32058245 CTGGAGAAAAGAATGGAGACAGG - Intronic
1023869608 7:44255980-44256002 CTGGACAGAAAAATGGGGAAAGG - Intronic
1024107318 7:46106371-46106393 CTTGAGACATAAAAAGAGAAAGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025120088 7:56294529-56294551 ATGGAGAGACAGATGGATAAAGG + Intergenic
1025287636 7:57679285-57679307 CTGGAGACATAAATAGAGGAAGG + Intergenic
1026009799 7:66628266-66628288 CGGGACACACAGATGGAGACAGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026427517 7:70311364-70311386 TGGGAGACAAGAATGGAGAAAGG - Intronic
1026434517 7:70383929-70383951 CTGAAGCCAAAAATGGGGAATGG - Intronic
1026788008 7:73313817-73313839 CTGGAGAAAGAAATGGACACTGG + Intronic
1026864881 7:73817400-73817422 CTGGAGAGAAAAATTAAGAAGGG - Intronic
1028421946 7:90642957-90642979 CTGGAGATGCAAAGTGAGAAAGG + Intronic
1028631522 7:92939838-92939860 CCAGAGACACATATGGAGAAAGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030552979 7:110987986-110988008 TTAGAAAAACAAATGGAGAAAGG + Intronic
1031540360 7:122987972-122987994 CTGGTAACATAAATGCAGAAAGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035078588 7:156198037-156198059 CTGGAGGAACACATGGAGAGAGG - Intergenic
1035670317 8:1412074-1412096 CTGGAGGCAGGAATGGAGAAAGG - Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036678367 8:10852910-10852932 CTGGTCTCACAAATGAAGAAGGG - Intergenic
1037387096 8:18354773-18354795 CTGGATACACAATTGTAGATTGG + Intergenic
1037613259 8:20494618-20494640 CAGCACACCCAAATGGAGAAGGG + Intergenic
1040029698 8:42813467-42813489 CTGGAAACTCACAGGGAGAAAGG + Intergenic
1040646737 8:49406183-49406205 CTGGAGATACAAATTGTGTAGGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041193664 8:55378694-55378716 AGAGAGACAGAAATGGAGAATGG + Intronic
1044476162 8:92628836-92628858 CTGAAGTCACAAGAGGAGAAAGG - Intergenic
1044836301 8:96298705-96298727 ATGGTGACATAAATGGAGTATGG - Intronic
1045355659 8:101386711-101386733 CTAGAGTCAGAAAAGGAGAATGG + Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1047819105 8:128499040-128499062 CTGGAGACCAAAAGGGACAATGG + Intergenic
1048021292 8:130541759-130541781 CTGGGGACATGATTGGAGAAGGG - Intergenic
1048466092 8:134665806-134665828 CTGGAGACCCCAGTGGGGAAGGG - Intronic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048936517 8:139362149-139362171 CTGGAGACAGCCATGGGGAAGGG + Intergenic
1050169415 9:2799806-2799828 CAGCAGACATAAAGGGAGAATGG + Intronic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1054803403 9:69375499-69375521 CTGGAGACTTTAAAGGAGAAAGG + Intronic
1057868691 9:98701724-98701746 CGGGAGACACACATGAATAAAGG + Intronic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1059108679 9:111534105-111534127 CTTGAGACAAAAATGGGAAAAGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059884904 9:118735077-118735099 CTGGAGACACTAGTGCAAAAGGG + Intergenic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1203618258 Un_KI270749v1:89889-89911 CAGGAATCAGAAATGGAGAAAGG + Intergenic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1187356744 X:18581166-18581188 GTAGAGATGCAAATGGAGAAAGG - Intronic
1188702732 X:33284631-33284653 CTGGAGACAAGAAGGGGGAAAGG - Intronic
1188821786 X:34784979-34785001 CTGGAGACAGAGATAGGGAAAGG + Intergenic
1188877494 X:35448451-35448473 CTCAAGACTCCAATGGAGAAAGG - Intergenic
1189877985 X:45456632-45456654 CTGAAGGCACAAATGGGGATAGG - Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190722432 X:53161099-53161121 CTGGAAAAACAAATAAAGAAGGG - Intergenic
1192000082 X:67140509-67140531 CTGGACCCAACAATGGAGAATGG - Intergenic
1193062240 X:77219582-77219604 ATGGAGTCAGAAATGGAGAATGG + Intergenic
1193276819 X:79598605-79598627 CTGGACAAATAAATAGAGAAGGG - Intergenic
1193630026 X:83873718-83873740 CTGGAGACTCAAAGGATGAAAGG + Exonic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194525606 X:94973305-94973327 CTGGACACAGAAATGGGCAAAGG - Intergenic
1194740314 X:97564722-97564744 TTGCAGAAACAAATGGGGAAAGG + Intronic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1197084769 X:122458909-122458931 ATGAAGACACAAATAAAGAAAGG + Intergenic
1198428175 X:136540454-136540476 GTGGAGACTTGAATGGAGAAAGG - Intronic
1199577021 X:149322179-149322201 CTGGTGGCACAACTGCAGAAAGG - Intergenic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic