ID: 1046860795

View in Genome Browser
Species Human (GRCh38)
Location 8:119089228-119089250
Sequence TAAGAATAGGAGACTAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 365}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046860795_1046860800 5 Left 1046860795 8:119089228-119089250 CCATTCCTAGTCTCCTATTCTTA 0: 1
1: 0
2: 1
3: 37
4: 365
Right 1046860800 8:119089256-119089278 CTAGGTCATGCCTACAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046860795 Original CRISPR TAAGAATAGGAGACTAGGAA TGG (reversed) Intronic
902646002 1:17798336-17798358 TTAGAATAGGTGACTGGGGAGGG + Intronic
903746724 1:25592039-25592061 AAAGAAAAGGAGAAAAGGAAAGG - Intergenic
904297061 1:29526678-29526700 TATGGACAGGAGATTAGGAAAGG + Intergenic
904586353 1:31583122-31583144 TGAGAAAAGGAGAGAAGGAAAGG - Intronic
904689159 1:32280944-32280966 TAAAAATAAGAGACTAGGCCAGG + Intronic
904781024 1:32948176-32948198 TAAGAGAATGAGACTACGAAAGG + Intronic
905659667 1:39711827-39711849 TAAGACAAGCAGACTTGGAAGGG + Intronic
905994631 1:42370820-42370842 AATGACTAAGAGACTAGGAAAGG + Intergenic
906059795 1:42941120-42941142 TAAGAATGTGAGACTAGAGACGG - Intronic
906940469 1:50251241-50251263 CAAAAATAGCAGACTAGGGAGGG - Intergenic
908685967 1:66720435-66720457 TAAGAACTGGAGACTAGGCATGG + Intronic
908708386 1:66987613-66987635 TCAGAATGGCAGACAAGGAATGG - Intronic
909633645 1:77792175-77792197 TAAAAAGAGGAGACTTGGTATGG + Intronic
910036728 1:82797901-82797923 TCAGAATAAGAGTCTAGCAATGG + Intergenic
911593430 1:99773751-99773773 TAAGAATAGGCGGCCAGGCACGG + Intergenic
911818792 1:102389310-102389332 TAAGATTAGGCCACTAGGGAAGG + Intergenic
911854837 1:102863291-102863313 TAAGAATGGGAGAATAGGCCGGG + Intergenic
912173447 1:107128696-107128718 TAAGAATGGGAGACTGGGACCGG - Intergenic
913284506 1:117214253-117214275 TAAGAAGAGGAGATTAGGGCTGG - Intergenic
915624891 1:157108351-157108373 TAAGAATCAGAGATTGGGAAGGG - Intergenic
916071916 1:161175419-161175441 TAAGAAGAGAAGGCTAGGTAAGG - Intronic
916729347 1:167552749-167552771 TAAGAATAGGAGCCCAGGCAGGG + Intronic
918985651 1:191622220-191622242 TATGATTAGGTGACTAGGGACGG - Intergenic
920516758 1:206590562-206590584 TGAGCATATGAAACTAGGAAAGG - Intronic
920659388 1:207902563-207902585 CAAGAAGAGGAGTCTTGGAATGG - Intronic
921487890 1:215736263-215736285 TAAGCATAGGATTCAAGGAATGG - Intronic
922018186 1:221674515-221674537 GAAAAATAGGAGACTCAGAAAGG - Intergenic
922629637 1:227093030-227093052 TAAGAAAAGGAGACATGGTAGGG - Intronic
922637829 1:227193513-227193535 TAGACATTGGAGACTAGGAAAGG - Intronic
922929140 1:229375287-229375309 TAAGAAAAGGAGACTGGGTGCGG - Intergenic
923027571 1:230218133-230218155 TAAGAACAGGGGACTAACAATGG + Intronic
923120891 1:230990284-230990306 TAAGAATAGTTAACTAAGAATGG - Intronic
924021050 1:239783422-239783444 TATTAATAGAAGACTAAGAAAGG + Intronic
1063078509 10:2741431-2741453 TAAGCAATGGAGACTGGGAAGGG - Intergenic
1066244742 10:33571525-33571547 TAAAAATAAGAGTTTAGGAAGGG - Intergenic
1068016780 10:51526531-51526553 TCAGAGTAGGAGATTAGGGAAGG - Intronic
1069517649 10:69091581-69091603 TAAGAATAGGAAATTAGGCTCGG + Intronic
1072551700 10:96483254-96483276 TAAGAATAAGGGAAAAGGAAGGG + Intronic
1073047018 10:100645466-100645488 TGAGAACAGGAGACTCGGCAGGG - Intergenic
1074067192 10:110026986-110027008 TAAGTACAGAAGACTAGAAAAGG - Intronic
1074794117 10:116923924-116923946 TAAGAAAAGGCAATTAGGAAGGG - Intronic
1075102972 10:119518994-119519016 AAGGAATTGGAGACTAGGCACGG - Intronic
1077052695 11:574895-574917 TCTGCAAAGGAGACTAGGAAGGG - Intergenic
1077802566 11:5555635-5555657 TAAGAATAGCAAACTGGGACAGG - Intronic
1078642302 11:13108113-13108135 TTAGAAAGGGAGACCAGGAAAGG - Intergenic
1078941445 11:16010926-16010948 TAATAATCGCAGACTTGGAAAGG + Intronic
1079157634 11:17963237-17963259 CAAGAGAAGGAGACTAGAAAGGG + Intronic
1079336405 11:19574403-19574425 GAAGAATAAGGGACTAGGAAGGG - Intronic
1079432371 11:20405099-20405121 GAAGAAAAGGAGGCTGGGAAGGG - Intronic
1079597975 11:22275747-22275769 TAAGGATAGGAGAGAAGGAAAGG + Intronic
1079715595 11:23739745-23739767 TAGGTACAGGAGACTTGGAAGGG - Intergenic
1080199448 11:29651430-29651452 TAAAAAGAGGTGACTAGAAAGGG - Intergenic
1080621877 11:33993503-33993525 TAAGAAGAGGAGATTAGGTTCGG - Intergenic
1080958149 11:37125589-37125611 TAAGAATAGGAGAGTGGTGAAGG + Intergenic
1081164623 11:39792274-39792296 TCAGAATAGCAGTCAAGGAATGG - Intergenic
1081236799 11:40656265-40656287 CAAGAATGGGAGAATAGGGAAGG - Intronic
1081392981 11:42551784-42551806 TGAGAATAGGATACAAGGGAGGG - Intergenic
1083389324 11:62336646-62336668 TAACAATAGGTCACTAGAAAGGG + Intergenic
1083574885 11:63783159-63783181 TAAAAATAGGAGGCTAAGACAGG + Intergenic
1084391372 11:68879420-68879442 GAACAAGAGGAGACTAGAAATGG - Intergenic
1084628041 11:70323975-70323997 GAAGAAAAGGAGGCTAGGACAGG + Intronic
1086919576 11:92571191-92571213 AAGGAATAGGAGCCTAGAAAAGG + Intronic
1087177991 11:95112563-95112585 TGAAAATAGGACACTAGGTAAGG - Intronic
1087443962 11:98222938-98222960 TAAGTAAATGAGACAAGGAAAGG + Intergenic
1087617582 11:100506089-100506111 TAAGAAGAGGAGATTAGAACAGG + Intergenic
1089102805 11:115977911-115977933 GAAGAAAATGAGACTGGGAAAGG - Intergenic
1089406472 11:118201812-118201834 TTAGATTAGGGGTCTAGGAAAGG + Intronic
1089629433 11:119774901-119774923 TGAGAACAGGAGAAAAGGAATGG - Intergenic
1090019179 11:123112090-123112112 TAAGAAAAGGCAACGAGGAACGG + Intronic
1090156650 11:124445122-124445144 TGAGACTAGGAGACTAGAGATGG - Intergenic
1091933896 12:4419608-4419630 TAGAAATTGGAGACTTGGAAGGG + Intergenic
1092405336 12:8218077-8218099 GAAGAATAGGAGCCTGTGAATGG + Intergenic
1092936748 12:13371276-13371298 TGAGAAAAGGAGAGCAGGAAAGG - Exonic
1093668819 12:21847989-21848011 AAACAATAGGAGTCAAGGAAAGG - Intronic
1093716248 12:22385766-22385788 CAAGAATGGCATACTAGGAAAGG - Intronic
1094660368 12:32464577-32464599 TAATAATAGAAGAATAAGAATGG + Intronic
1095467007 12:42498136-42498158 AAAGAAAATGAGACTAGGCATGG - Intronic
1095623592 12:44287128-44287150 TTAGAATGTGAGACTAAGAAGGG - Intronic
1096282467 12:50268089-50268111 TAAGAATCAGACACCAGGAAAGG - Intronic
1096691900 12:53326541-53326563 TGAGAAAAGGAGAAGAGGAAGGG - Intergenic
1097498149 12:60369181-60369203 TAAGATTAGGAGACAAAAAAAGG + Intergenic
1098003622 12:65971367-65971389 TAGGCATAGGAGACTATAAAGGG - Intergenic
1098661815 12:73103839-73103861 TAGGAATAGCAGAAGAGGAAAGG - Intergenic
1098983910 12:76989281-76989303 AAAGAATATGAGACAAAGAAGGG + Intergenic
1099029757 12:77511694-77511716 TAAGCAAAGTAGACTAGAAATGG - Intergenic
1099379341 12:81936215-81936237 GAAGAAGAGGAGACTAGGCCTGG - Intergenic
1099533201 12:83813086-83813108 TAGTAACAGGAGAGTAGGAAAGG - Intergenic
1100093998 12:91008861-91008883 AGGGAATAGGAGCCTAGGAATGG - Intergenic
1100144388 12:91659433-91659455 TATGTATAGGAGATTTGGAAAGG - Intergenic
1100845064 12:98649921-98649943 TAGGGATGGGAGACTAGGGAAGG + Intronic
1101049360 12:100845072-100845094 TAAGAACCGGAGAGCAGGAAAGG + Intronic
1101574933 12:105988410-105988432 AAAGAATGGGGGACTGGGAAGGG + Intergenic
1101992928 12:109502036-109502058 TAAGAATAGAAAACAAGGATTGG + Intronic
1103554739 12:121759206-121759228 TAAGAACAGGAGACTTGGCTGGG - Intronic
1103844388 12:123891439-123891461 TCAGAATAGGAGCCTAGGGTGGG + Intronic
1106341546 13:28833527-28833549 TAAAAATACAAAACTAGGAATGG + Intronic
1109215889 13:59589456-59589478 TAATAATAGGAGAATAGAAGAGG - Intergenic
1110605526 13:77427564-77427586 TAAGAAGAGGAGAATAGGGCCGG - Intergenic
1111828725 13:93300356-93300378 TAAGAATAGGAGGCTGGGCACGG + Intronic
1111994249 13:95148060-95148082 AAACAATAGGAGTCTGGGAAGGG - Intronic
1112753820 13:102608730-102608752 GCAGAATAGGAGACTAAGAAAGG - Intronic
1112927954 13:104700340-104700362 AAAGAATAAGAGACAATGAAGGG - Intergenic
1116183185 14:41561700-41561722 TAAAAAATGGAGACTAGCAAGGG - Intergenic
1116265003 14:42676692-42676714 TAATTATTGGAGGCTAGGAAGGG + Intergenic
1116284254 14:42951373-42951395 TAAGAATAAGAGGCCAGGTATGG - Intergenic
1116287931 14:42996629-42996651 TAAACATTGGAGACTTGGAAAGG - Intergenic
1117187473 14:53255365-53255387 TAAAAATGGGAAACTAGAAAGGG - Intergenic
1118525144 14:66631992-66632014 TACGAATAGGAAATTAGGTAGGG - Intronic
1118867937 14:69718013-69718035 TATGGAGAGGAGACTAGGGAAGG + Intergenic
1119232221 14:72989285-72989307 TTAGAAAAGGACACTAGGCAGGG + Intronic
1119335997 14:73834206-73834228 TTAGCATAGGATAATAGGAACGG - Intergenic
1119751661 14:77082889-77082911 TGTGAATAGCAGACCAGGAATGG + Intergenic
1120101795 14:80453104-80453126 AAAGAATGGGAGACTGGGAAGGG - Intergenic
1121198098 14:92093216-92093238 TAAGAAAAAAAGACAAGGAAGGG + Intronic
1121561959 14:94882506-94882528 TAAGAAGAGGAGATTAGGACAGG + Intergenic
1123168197 14:106346645-106346667 TAAGAACAGGAAACTTGGGAAGG + Intergenic
1125052929 15:35322273-35322295 TAAGAATAGGATTATGGGAAGGG - Intronic
1126270814 15:46814964-46814986 TTAGAATAAGAGGCCAGGAATGG + Intergenic
1126451479 15:48813417-48813439 TAAGCCTGGGAGAATAGGAAGGG + Intergenic
1126452716 15:48827006-48827028 TATGCATAGGGTACTAGGAAGGG - Intronic
1127030793 15:54859647-54859669 TCAGACTAGGAAACAAGGAAAGG + Intergenic
1128068115 15:64776489-64776511 TCAGAATAGGAGGCAGGGAAAGG - Intergenic
1128616129 15:69111429-69111451 TAAGAAAAGGAGATCAGGACCGG + Intergenic
1129569630 15:76666928-76666950 TAAAAATGCGAGACAAGGAATGG - Intronic
1130171581 15:81520244-81520266 AAAGAAGAGGAGGCTAGGCACGG + Intergenic
1131167192 15:90150798-90150820 TAAGAAGAGAAGATTAGGCAGGG - Intergenic
1134399992 16:13900940-13900962 TAAGAATAGCAGAGTAGGGCAGG - Intergenic
1134909979 16:18016938-18016960 TAAACATTGGAGACTTGGAAGGG + Intergenic
1135255002 16:20934102-20934124 AAAGCATAGGAGAATAGGGAGGG + Intronic
1135391619 16:22098378-22098400 TAATTAAAGGAGACGAGGAAAGG + Intronic
1135932268 16:26748108-26748130 AAAAAATAGAAGACCAGGAAAGG - Intergenic
1136133771 16:28241680-28241702 TAAGAAGAGGAGATTAGGGCTGG - Intergenic
1138045139 16:53714540-53714562 TAAGAATATGAGAATAGCACCGG + Intronic
1138472744 16:57251105-57251127 GAAAAATAGGAGACTGGGCATGG + Intronic
1138548955 16:57736584-57736606 TAAGCTTAGGGGCCTAGGAAAGG - Intronic
1139066277 16:63319120-63319142 TTAGAATAGCAAAGTAGGAATGG - Intergenic
1140231684 16:73122649-73122671 TAGGAACAGGATGCTAGGAAGGG - Intergenic
1140864189 16:79045530-79045552 TGGGAAAATGAGACTAGGAATGG - Intronic
1141395000 16:83696787-83696809 TAAGAATGGGAGACAAGTTAGGG - Intronic
1142730679 17:1854407-1854429 TAAAAATAGGAAACCAGGTACGG + Intronic
1143176983 17:4961165-4961187 TAAGAATAATAGACCAGGCATGG + Intronic
1143806091 17:9428101-9428123 TAGAAATGGGAGACTTGGAAAGG - Intronic
1144490158 17:15701482-15701504 TGAGCATAGGAGGCTAAGAAAGG - Intronic
1144910805 17:18680475-18680497 TGAGCATAGGAGGCTAAGAAAGG + Intronic
1146718347 17:35104957-35104979 TAAGAATCTGAGACTAGGAGCGG - Intronic
1147025451 17:37578804-37578826 TAAGAATAAGGAGCTAGGAAAGG - Intronic
1147411261 17:40254305-40254327 TAAGATTAGGAGGCCAGGCATGG - Intronic
1147538639 17:41337196-41337218 TGGAAATAGGAGACTGGGAATGG - Intergenic
1148949075 17:51293340-51293362 TAGGCATTGGAGACTTGGAAAGG + Intronic
1149302330 17:55316922-55316944 TAAGAAGACAAGACTAGGAAAGG - Intronic
1149420055 17:56501715-56501737 TAAGAAGAGGAGACTGTGGAAGG + Intronic
1150001116 17:61440740-61440762 AAAGAAAAGGAGACCAAGAATGG - Intergenic
1150215108 17:63463276-63463298 TAAGAATGGGATGCTTGGAAGGG - Intergenic
1150494035 17:65593609-65593631 TAAGAATAGAAGACCCGGGAGGG + Intronic
1150848900 17:68686243-68686265 CTAGAATAGGAGACGATGAACGG - Intergenic
1151549104 17:74811406-74811428 TAAGAATAGTAGAATAGTACTGG + Intronic
1151762913 17:76116843-76116865 TAAAAATAGGAGGCCAGGCATGG - Intronic
1156594804 18:38536155-38536177 TAAGAAAGGAAGGCTAGGAATGG + Intergenic
1158349867 18:56554247-56554269 CAAGAAATGGAGACTAGGAAAGG - Intergenic
1158690025 18:59652033-59652055 GAAAAATAAGAGACTGGGAAGGG - Intronic
1158903668 18:61989766-61989788 TAAGAATGGGAGAAGAGGAAAGG + Intergenic
1158928135 18:62292140-62292162 GAAGAATAAGAGACTTGGAGAGG - Intronic
1159152749 18:64541029-64541051 TAAGAATCTGAGACTATGAAGGG - Intergenic
1159556597 18:69952271-69952293 GAAGAATGGGAGAGTAGAAAGGG + Intronic
1159644703 18:70903718-70903740 GGAGAAGAGGAGACTAGGAGGGG - Intergenic
1161835252 19:6641596-6641618 TAAGAAAAGGAGATTAGGACAGG - Intergenic
1162307105 19:9881792-9881814 TAAGAAAAGGAGATTAGGTCCGG - Intronic
1163504231 19:17695320-17695342 AAAGAATAGAAGAGAAGGAAGGG + Intergenic
1164019521 19:21286796-21286818 CAAGAAAAGGAGAGAAGGAAAGG - Intronic
1164019525 19:21286846-21286868 AAAGAAAAGGAGAGAAGGAAAGG - Intronic
1164311091 19:24047170-24047192 AAAAAATAGGAAAATAGGAAAGG - Intronic
1164425620 19:28138898-28138920 TAGGAATGGGGCACTAGGAAGGG + Intergenic
1164434853 19:28220261-28220283 GAAGAATAGGAGAGTTGAAAAGG + Intergenic
1165870217 19:38966556-38966578 TAAGAACAGGATACTATAAAAGG + Intronic
1166253196 19:41585364-41585386 TTAAAATAGGGGACCAGGAAAGG - Intronic
1166354833 19:42220773-42220795 AAAGAATCGTAGACGAGGAAAGG + Intronic
1166648521 19:44552064-44552086 TAAAAATAGATGACTCGGAAAGG + Intergenic
1168239663 19:55082688-55082710 TAGGACTAGGAGAGTAGGGAGGG + Intronic
925474853 2:4201944-4201966 CCAGCAAAGGAGACTAGGAAAGG - Intergenic
925771170 2:7284442-7284464 TGAGAATATTAGAATAGGAATGG - Intergenic
925862104 2:8188974-8188996 TAAGAATAGGAGACAAGACCTGG - Intergenic
927097262 2:19756992-19757014 TATGAATAGGAGATTTGGGATGG + Intergenic
927279206 2:21288823-21288845 CAAGAATTGGGGACTAGGAAGGG - Intergenic
927571957 2:24167703-24167725 AAGGAATAGGAGAGTAAGAAGGG - Intronic
928432938 2:31235105-31235127 TAAGATGGGGAGACTGGGAATGG - Intronic
928828042 2:35443537-35443559 TGAGAATATGAGACAAGAAATGG - Intergenic
929616574 2:43314330-43314352 TATAAAATGGAGACTAGGAAAGG + Intronic
929745171 2:44649752-44649774 TAAGGACAGGAGAGCAGGAATGG - Intronic
932581061 2:72992976-72992998 CCTGAATAGGAGGCTAGGAAGGG + Intronic
932969697 2:76525564-76525586 CAAGAATAGGAGACGTGGAAGGG - Intergenic
933221362 2:79693226-79693248 CAATAATAGGAAACTAGAAATGG + Intronic
934745842 2:96759253-96759275 GAGGAATAGGAGCCTTGGAATGG - Intergenic
936898551 2:117457429-117457451 TAGGCATTGGAGACTCGGAAGGG - Intergenic
937705557 2:124916602-124916624 GAAGAAATGGAGACTAGCAAAGG + Intergenic
937745642 2:125409769-125409791 AGAGTATAGGAGACTAGTAAAGG + Intergenic
937873886 2:126805664-126805686 AAATAATAGGAGAATAAGAATGG - Intergenic
939202410 2:139054472-139054494 AAAGAAAAGGAAACTAAGAAAGG - Intergenic
939821255 2:146959543-146959565 CAAGTCTATGAGACTAGGAAAGG + Intergenic
940663526 2:156577152-156577174 TAAGAAAAGGAAAGCAGGAAAGG + Intronic
940740001 2:157496708-157496730 AAAGAATAGGGGAATGGGAATGG - Intergenic
940899918 2:159117303-159117325 TAATAAGAGGAGACTTGGTATGG - Intronic
942759312 2:179379751-179379773 TAAGAATAAAAGACTAAGACTGG - Intergenic
942994839 2:182248833-182248855 TAAGAATAGTAAAGCAGGAAAGG - Intronic
943273593 2:185839948-185839970 TAAAAACAGCAAACTAGGAAGGG + Intergenic
943404278 2:187460794-187460816 TAAGAACAGGAGACTGTGGAGGG - Intergenic
943838466 2:192546444-192546466 TAAAAATAGTAGACTTTGAAAGG + Intergenic
943864220 2:192908201-192908223 GAAGAATAGGAGGCTGGGCACGG + Intergenic
943876299 2:193071867-193071889 TAAGAGAGGGAGAATAGGAAAGG - Intergenic
944355553 2:198783483-198783505 TAAGAGAAGGTGACTAGGAAGGG - Intergenic
944434038 2:199667426-199667448 CAAGAATTGGAGACTAGCCAGGG + Intergenic
944566797 2:200999683-200999705 TAAGAATAGGGGAATAGGCTGGG - Intronic
945650092 2:212546733-212546755 TTAGAATGGGAGAGTAGGAGAGG + Intergenic
945965169 2:216179327-216179349 TAAGATGAGGTCACTAGGAAAGG - Intronic
946995392 2:225384922-225384944 TGAGAACATGAGACTTGGAAGGG + Intergenic
947260481 2:228216367-228216389 TAAGAATGAGAGACAAGAAATGG - Intergenic
1168895042 20:1318510-1318532 TAAGAAATGGAGCCTGGGAATGG + Intronic
1171032315 20:21688372-21688394 TAATAATTGGAGACCAGGAATGG + Intergenic
1172375736 20:34438446-34438468 TAAGAAGAGGGGAAAAGGAAGGG - Intronic
1173183772 20:40823657-40823679 AAAGACGAGGAGAATAGGAAAGG - Intergenic
1173631221 20:44517282-44517304 TAAGAATTGGAGACTGAGACTGG - Intronic
1173877746 20:46386031-46386053 TAAGCAAAGGAGAGTAGGATTGG + Intronic
1177890158 21:26795270-26795292 TAGGGATAGGAGACTGTGAAAGG + Intergenic
1178254434 21:31038794-31038816 TAAGAATTGGATACTGGGAAGGG - Intergenic
1181745170 22:24951102-24951124 TGTGAGTAGGAGACCAGGAACGG - Intergenic
1181827592 22:25531048-25531070 TAAGATTATGAGAGTATGAAAGG + Intergenic
1182595190 22:31414065-31414087 CAAGCAAAGGAGACCAGGAAGGG - Intronic
950091011 3:10294425-10294447 AAAGAAGAGGACACAAGGAAAGG - Intronic
950985004 3:17353751-17353773 TAAGAAGATGAGAAGAGGAATGG + Intronic
951407876 3:22323376-22323398 TAAGTAGATGAGACTGGGAATGG + Intronic
951455797 3:22890869-22890891 TAATAAAAGGAGACTTGGATGGG - Intergenic
951932643 3:27985876-27985898 TAAGAGTAGGAGATTAGGGCAGG + Intergenic
951987982 3:28642196-28642218 TAAGACTAAGAGACTTGGACTGG - Intergenic
952052178 3:29397644-29397666 GAAGAAGAGGATAATAGGAAAGG - Intronic
952071825 3:29646723-29646745 CAGGAATAGGAGACAGGGAAGGG - Intronic
952142379 3:30494312-30494334 TTAGATCAGGAGGCTAGGAAAGG - Intergenic
952680847 3:36089729-36089751 TAAGAATCAGAAACTATGAAAGG + Intergenic
953086580 3:39674238-39674260 TGAGAATAAGAGAATAAGAAAGG + Intergenic
953509014 3:43516525-43516547 TAAGAAAAGGAAACCAGCAAAGG + Intronic
955561854 3:60200111-60200133 TAAGACTTGGACACTAGGGATGG + Intronic
957171107 3:76737854-76737876 TAAGAAATGCAGACTGGGAACGG + Intronic
957358132 3:79117881-79117903 TAAGAATTAGAGATTAGGAAGGG + Intronic
959306002 3:104666628-104666650 TAAGAACATGAGATTAGGGAGGG + Intergenic
959337441 3:105083727-105083749 TATGAATAGGGGAGTAGCAAGGG + Intergenic
959374429 3:105571068-105571090 AAAGAATAAGAGCCTAGGCATGG + Intronic
959929746 3:111966821-111966843 TAAGAAAATGAGACTGAGAAAGG - Intronic
960493011 3:118340124-118340146 TAAGAAAAAGAGCCTATGAAAGG - Intergenic
960735228 3:120772149-120772171 TTAAAATAGGACACAAGGAAGGG - Intronic
961492414 3:127264919-127264941 TAAGCATAGGAGAGAAGGAGGGG + Intergenic
961704724 3:128775087-128775109 TAAGAAAAGGACATTAAGAAGGG - Intronic
962990563 3:140573686-140573708 GAAGAGTAGCAGTCTAGGAAAGG + Exonic
963034338 3:141012611-141012633 TAAGGATAAGGGAATAGGAACGG - Intergenic
963349283 3:144132981-144133003 AAAGAAAAGGAGGCTGGGAATGG - Intergenic
963359907 3:144258193-144258215 TAAGATGAGGAGACTACAAAAGG + Intergenic
963645308 3:147906189-147906211 GAAAAATAAGAAACTAGGAAAGG + Intergenic
963982032 3:151549145-151549167 TAAGAATAGGACACTAAAAATGG + Intergenic
964068633 3:152605408-152605430 TGAGAATAGGAGACCAGGAATGG + Intergenic
964167436 3:153725568-153725590 CAAGAATAGGAGACAAGGCCAGG - Intergenic
964675690 3:159277559-159277581 TCAGAATATGTGACTAGTAAGGG + Intronic
964687591 3:159414369-159414391 TAAGATAAGGAAACTAGGGATGG + Intronic
964822735 3:160791308-160791330 TGAGAAACAGAGACTAGGAAAGG - Intronic
964999417 3:162933882-162933904 TAAGATTAGTAGACAAAGAATGG - Intergenic
965091289 3:164165584-164165606 CAAGAACAGGAGACAAGAAATGG + Intergenic
965207657 3:165742855-165742877 TCAGAATAGGGGACTATAAAGGG + Intergenic
965790827 3:172386337-172386359 TAAGCATTGAAGACAAGGAAAGG + Intronic
966247689 3:177826702-177826724 AACGAATAGGGGACTGGGAATGG - Intergenic
966443394 3:179973602-179973624 TTAGAATAGGAGATTAAAAAGGG - Intronic
967281241 3:187826148-187826170 TAAGAATACGAGACTCAGAGGGG + Intergenic
967567940 3:190993261-190993283 TGTGAATAAGAGACTAAGAAAGG - Intergenic
971526865 4:27630567-27630589 TAAGAATAAGGGATAAGGAAAGG - Intergenic
972088530 4:35251465-35251487 TAAGAATTTGAGATGAGGAAAGG - Intergenic
972482572 4:39511564-39511586 TAAAAATAGGGGAATAAGAAAGG - Intronic
972936396 4:44141227-44141249 TAATAATAGGAGAATGGGATTGG - Intergenic
972943753 4:44228309-44228331 TAATAAGAGGAGATTAGGACAGG - Intronic
973839509 4:54846588-54846610 TAAGAAGAGGAGATTAGGGCAGG - Intergenic
974271106 4:59652285-59652307 TAAGAATATGAGATTTGGGAGGG + Intergenic
974292045 4:59945173-59945195 TAAGAAGGGGAGATGAGGAAAGG + Intergenic
974779340 4:66531380-66531402 TAAGTATAGCAGACTACTAAAGG + Intergenic
975681793 4:76884816-76884838 AAAGAAGAGGAAACAAGGAAAGG + Intergenic
979909680 4:126346841-126346863 TAACAAAAAGAGGCTAGGAATGG + Intergenic
979936093 4:126698329-126698351 TAAGTATATTAGACAAGGAATGG + Intergenic
980211642 4:129795946-129795968 TAAGAAGAAAAGAGTAGGAAGGG + Intergenic
982036158 4:151348086-151348108 TTAGAAAAGGAGAAGAGGAAGGG + Intergenic
982743527 4:159082560-159082582 TGAGAATAGGAGGTTAAGAAAGG + Intergenic
984479169 4:180276836-180276858 GAAAAGTAGGAGACTAGGAGAGG + Intergenic
985811115 5:2087045-2087067 TTAGAATAGGAGACGAGCCATGG + Intergenic
986590754 5:9366956-9366978 AAAGAATACCAGACTAGGAAAGG - Intronic
987574864 5:19712136-19712158 TAAGTATTGGAGACTCTGAAGGG + Intronic
987739749 5:21891905-21891927 TAAGAAAAGAAAACTAGGAAAGG + Intronic
988521802 5:31952767-31952789 TAAGAATAGCAGCCCAGGCACGG + Intronic
989130360 5:38100978-38101000 TAAGAATAGAAGAGTAGGGAGGG + Intergenic
989167628 5:38446509-38446531 GAGGAAGAGGAGACGAGGAAGGG - Intronic
990039667 5:51363769-51363791 GAAGCATATGAGACTAGCAACGG - Intergenic
990485331 5:56252838-56252860 TAAAAATAACATACTAGGAAAGG + Intergenic
990552837 5:56901299-56901321 TGAGAACAAGAGACCAGGAAAGG - Intergenic
993962588 5:94318568-94318590 CAATTATTGGAGACTAGGAAAGG + Intronic
994232656 5:97325676-97325698 TAAGATTTGGAGACTATGACAGG + Intergenic
994260197 5:97649356-97649378 TACAAATAGTAGACTAGGATTGG + Intergenic
994433893 5:99704078-99704100 TAAAAATAAGAGACTGGGCATGG + Intergenic
995022637 5:107383247-107383269 TTAGCTTAGGAGACTAGAAAAGG + Intronic
995637161 5:114206644-114206666 AAAGAAAAGGAGACCAGTAAAGG - Intergenic
995998384 5:118327961-118327983 AAACAATAGGAGACCAGGATCGG + Intergenic
997965263 5:138351988-138352010 TAACATTGGCAGACTAGGAAGGG + Intergenic
998997999 5:147887714-147887736 AAAGAATAGGATCCTAAGAAAGG + Intronic
999063601 5:148661068-148661090 GAAAAGTAGGAGACAAGGAATGG + Intronic
999686759 5:154110147-154110169 TAAGAAGGAGAGACTTGGAAAGG + Intronic
1000041282 5:157486923-157486945 TAAGAAGAGGAGAGTTGGACAGG + Intronic
1001220378 5:169895377-169895399 CCAGGATAGGAGACTAGGAAAGG + Intronic
1001670998 5:173473878-173473900 AAAGAGGAGGAGACTGGGAAAGG + Intergenic
1003095319 6:3138306-3138328 AAAGAATAGGAGGCTGGGCATGG - Intronic
1003357919 6:5392190-5392212 TAAGGATAGGAAACTCAGAAAGG - Intronic
1003840295 6:10112940-10112962 GAAGGAGAGGAGACCAGGAAAGG - Intronic
1004456575 6:15797106-15797128 TAAGAAGAGGACACCAGGAATGG + Intergenic
1006352186 6:33529435-33529457 AAAGAATTTGAGACTAGGCACGG + Intergenic
1007299654 6:40857172-40857194 TGAGAACAGGAGAAGAGGAAAGG + Intergenic
1010048070 6:71470529-71470551 TAGGCATGGGAGACTAGGAAGGG - Intergenic
1010116258 6:72316317-72316339 AGAGAAGAGGAGACAAGGAAGGG + Intronic
1011350184 6:86414436-86414458 TCTGAATAGGAGACAGGGAATGG + Intergenic
1011424261 6:87209302-87209324 TAAGAATAGGAACATGGGAATGG - Intronic
1011587581 6:88943348-88943370 TGAGAAAAGGAGAATAGGCAAGG - Intronic
1012580475 6:100863319-100863341 TAAGAATATTAGTGTAGGAAGGG + Intronic
1013572716 6:111445811-111445833 TAGGAAAAGGAGACTGGAAAAGG + Intronic
1014305235 6:119733001-119733023 TAAGAATAGAAGTCAAAGAATGG - Intergenic
1014403318 6:121017498-121017520 GAAGGAAATGAGACTAGGAATGG - Intergenic
1014791647 6:125679084-125679106 GAATAATAGGAGACTTGCAAAGG + Intergenic
1020192742 7:6012938-6012960 TAAGAGCAGCAGACTAGGAGAGG + Intronic
1020462828 7:8443304-8443326 AAAGAATGGGAGACTGGGTAGGG - Intronic
1021760587 7:23899816-23899838 TAAGATAATGAGACCAGGAAGGG - Intergenic
1022208945 7:28189557-28189579 TAAGAATAAGAGACTGAGTAGGG - Intergenic
1023461607 7:40404014-40404036 TAGGAAAAGGAGATAAGGAAGGG + Intronic
1023568000 7:41542564-41542586 TTAGAATAGGAGACAAGGAGGGG - Intergenic
1027691315 7:81349458-81349480 TAATTACAGGAGATTAGGAAGGG - Intergenic
1027937270 7:84623951-84623973 CAAAAATAGAAGACTAGCAAAGG + Intergenic
1028006823 7:85582760-85582782 TAAGAATTGGATAAGAGGAAAGG - Intergenic
1028988854 7:97028163-97028185 TAATAATAAAAGGCTAGGAAAGG - Intergenic
1029845598 7:103409078-103409100 TTAGATTAGGGGTCTAGGAAAGG - Intronic
1030464197 7:109879238-109879260 TAAGGATGGGAGACTAAGAATGG - Intergenic
1032691525 7:134292421-134292443 TATGAATAGGAGGCTATGTATGG - Exonic
1032866140 7:135926051-135926073 TAAGAATTGGAATCTAGGACCGG - Intergenic
1033527652 7:142232366-142232388 TAAGAATAAGAGATGAGGAAGGG + Intergenic
1034746962 7:153531425-153531447 TAAGAACAGTAGACTCAGAATGG - Intergenic
1035403359 7:158583084-158583106 GAGGAATATGGGACTAGGAAGGG - Intronic
1036175470 8:6533860-6533882 TAAGAGTAGGAAAATAGGATGGG + Intronic
1036712487 8:11089853-11089875 TAAGAATAGTAGAATATGCATGG - Intronic
1036918793 8:12832035-12832057 CAAGGATAGGAGACCAGGGAGGG - Intergenic
1037722558 8:21457430-21457452 TAAGAATATGAGATTTGGAAGGG + Intergenic
1042493313 8:69427640-69427662 TAATAATAGGAGACTGTGTAAGG - Intergenic
1044410884 8:91881397-91881419 TAAGAAGAATAGACTAGAAAGGG + Intergenic
1044473739 8:92602425-92602447 GAAGAATAGTGGAATAGGAAGGG + Intergenic
1045558151 8:103234921-103234943 TAAGATTAGAAGATTAGGACAGG + Intergenic
1046561933 8:115848758-115848780 TGAGAACAGGAGACTGAGAAAGG - Intergenic
1046860795 8:119089228-119089250 TAAGAATAGGAGACTAGGAATGG - Intronic
1046905025 8:119563262-119563284 TAAGAATTGGAGACAGGTAATGG + Intronic
1046911789 8:119636132-119636154 TAAGAATAAGACACTAGGTGGGG - Intronic
1046994034 8:120495620-120495642 TAGTAATATGAAACTAGGAATGG - Intronic
1047000740 8:120570079-120570101 TAAGATGAGGAGACTGAGAAAGG - Intronic
1047067773 8:121305629-121305651 AAAGAATAGGAGAGCAAGAAGGG + Intergenic
1047786062 8:128154819-128154841 TAAGAAAAGGAGATTAGGGCCGG - Intergenic
1048104259 8:131390155-131390177 TAGAAATTGGAGACTTGGAAAGG - Intergenic
1048486459 8:134852327-134852349 TAAGAATTGGAGGCCAGGCATGG + Intergenic
1049791322 8:144473956-144473978 TGAGAAGAGGGGACTAGGAAGGG + Exonic
1050368155 9:4892030-4892052 TCATAATAGGAGAATAGGGATGG + Intergenic
1050432723 9:5578152-5578174 TAGGACTCTGAGACTAGGAATGG - Intergenic
1055654701 9:78440636-78440658 GAACAATAGGAGAGTAGGTAAGG + Intergenic
1055686583 9:78781657-78781679 CAAGAATAGGACTATAGGAAGGG + Intergenic
1056458215 9:86783963-86783985 TAAGAATAAGAGTTTAAGAATGG - Intergenic
1056487123 9:87070577-87070599 TAAAAATAGAAAACTTGGAAGGG - Intergenic
1057978724 9:99635963-99635985 TGAGACTATGAGACTAGGAAGGG + Intergenic
1058756699 9:108089234-108089256 TAATAACAGGAGAGGAGGAAAGG - Intergenic
1059027588 9:110652102-110652124 TTAGATAAGAAGACTAGGAATGG - Intergenic
1059147615 9:111915066-111915088 TAGGAAGAGGAGACAAGGAGAGG + Intronic
1059370453 9:113827780-113827802 TAATCAAAGGAGACCAGGAATGG + Intergenic
1059909753 9:119029525-119029547 TAACAATAGGACACTAGAGAAGG + Intergenic
1061020791 9:128013247-128013269 TAAGGAAAGGAGAATAGGGAGGG + Intergenic
1062682031 9:137787383-137787405 TGAGAAGAGGGGACTAGGAAGGG + Intronic
1185791839 X:2933062-2933084 TAAGAAGAGGAGATTAGGGCCGG + Intergenic
1185815377 X:3150277-3150299 TAAGAAGAGGAGAGGAGGACTGG - Intergenic
1185964532 X:4585850-4585872 TAAGAAGAGGAGGCTGGGCATGG + Intergenic
1187609457 X:20925773-20925795 TAACAATCGGAGACTTTGAATGG - Intergenic
1188005672 X:25014266-25014288 TAAAAATGAGAGAGTAGGAAAGG - Intronic
1189100186 X:38181103-38181125 CAAGAAGAGAAGATTAGGAAAGG - Intronic
1189247188 X:39572337-39572359 TAAGAAGAAGAGACTAGGCAAGG + Intergenic
1189367961 X:40403632-40403654 TAAGAATAGGAGGCCAGGCACGG + Intergenic
1190016033 X:46828171-46828193 TAAGAAGAGGAAACTAGGCTGGG + Intergenic
1190358876 X:49630747-49630769 TCAGAGTAGGATCCTAGGAAAGG - Intergenic
1190384954 X:49876148-49876170 TATGAATAAGTGAATAGGAATGG - Intergenic
1192209652 X:69119686-69119708 GAAGAAAAGGAGTCTGGGAAAGG - Intergenic
1192415160 X:70973176-70973198 TAAGAAGAGGAGGCCAGGCAGGG + Intergenic
1192469709 X:71387463-71387485 TAAGAATGGGAGGATAGGGAGGG + Intronic
1192745370 X:73933230-73933252 TAAGAATAGTAGGCTGGGCATGG + Intergenic
1194171990 X:90598448-90598470 TAAGATTAAGATACTTGGAATGG - Intergenic
1195339204 X:103888954-103888976 TAAACATTGGAGACTTGGAAAGG + Intergenic
1195712704 X:107786952-107786974 TAAGATTGGGAAACTAGGAGAGG + Intronic
1196219595 X:113097152-113097174 TATGCATAGGAGAGTAGGAGAGG - Intergenic
1196286386 X:113885714-113885736 TAAGAGTAGGAGTTTTGGAAGGG + Intergenic
1197846357 X:130807772-130807794 CCAGAATAGTAGACTAAGAAGGG + Intronic
1198588022 X:138144459-138144481 TTAGAAAGTGAGACTAGGAAAGG + Intergenic
1199164794 X:144658901-144658923 AAAGAATAGGTGACTGAGAAGGG - Intergenic
1199807147 X:151311601-151311623 TAAAAATAGTATAGTAGGAAAGG - Intergenic
1199869889 X:151888821-151888843 TAAGAATATGAGATTTGGGAGGG + Intergenic
1199906059 X:152232407-152232429 AAAGGGTAGGAGAGTAGGAAGGG - Intronic
1200518219 Y:4176196-4176218 TAAGATTAAGATACTTGGAATGG - Intergenic
1200972025 Y:9162998-9163020 AAAAAACAGGAAACTAGGAAGGG - Intergenic
1201265921 Y:12206454-12206476 TAAGAAGAGGAGAGGAGGACTGG + Intergenic
1202139001 Y:21701292-21701314 GAAAAACAGGAAACTAGGAAGGG + Intergenic