ID: 1046860796

View in Genome Browser
Species Human (GRCh38)
Location 8:119089233-119089255
Sequence GAAGCTAAGAATAGGAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046860796_1046860800 0 Left 1046860796 8:119089233-119089255 CCTAGTCTCCTATTCTTAGCTTC 0: 1
1: 0
2: 1
3: 24
4: 218
Right 1046860800 8:119089256-119089278 CTAGGTCATGCCTACAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046860796 Original CRISPR GAAGCTAAGAATAGGAGACT AGG (reversed) Intronic
900253549 1:1684458-1684480 GAAATTAAGAATAGGAGGCCGGG + Intronic
903339522 1:22644941-22644963 GAGGCTATGAATGGGTGACTGGG + Intronic
904272227 1:29357530-29357552 GAAGCTGAGAAGAGCAGGCTTGG - Intergenic
904455768 1:30647128-30647150 GAAGCCAAGAGGAGGAAACTCGG + Intergenic
904689158 1:32280939-32280961 GATACTAAAAATAAGAGACTAGG + Intronic
904716970 1:32475742-32475764 GAAGGTAAGAAGAGGGGACAGGG + Intronic
906400615 1:45501621-45501643 GAAGCTAATATTATGACACTGGG + Intronic
906594677 1:47064379-47064401 GAGGCTAAAAATAGGACCCTAGG - Intergenic
906769726 1:48472746-48472768 GAATCACAGAATAGGAGACTAGG - Intergenic
907942424 1:59101815-59101837 GAAGCTCAGGATAGGCCACTGGG - Intergenic
907952733 1:59199222-59199244 GAAGCTTTGGATAGGATACTGGG - Intergenic
909836147 1:80258137-80258159 GCAGCGAAGAATAGAATACTGGG + Intergenic
910608845 1:89117568-89117590 AAAGCTAAGAAAAGGTTACTGGG - Exonic
910971809 1:92863517-92863539 GAAGCTAAGAGTTCAAGACTAGG + Intronic
912306029 1:108568423-108568445 TATGCTAATAACAGGAGACTGGG + Intronic
913413684 1:118580981-118581003 GATGCCAAGAATAGGAGAGAAGG + Intergenic
913520210 1:119638575-119638597 GGAGTTAAGAAGAGGAGACAGGG - Intronic
913555395 1:119961521-119961543 GGAGAAAAGAATAGGAAACTGGG - Intronic
913649565 1:120899358-120899380 AGAGCCAAGAATGGGAGACTGGG - Intergenic
914077119 1:144364171-144364193 AGAGCCAAGAATGGGAGACTGGG + Intergenic
914102059 1:144602334-144602356 AGAGCCAAGAATGGGAGACTGGG - Intergenic
914171571 1:145229738-145229760 AGAGCCAAGAATGGGAGACTGGG + Intergenic
914526680 1:148473706-148473728 AGAGCCAAGAATGGGAGACTGGG + Intergenic
914911281 1:151789492-151789514 GAAGCTAAGAAGAGAAGATGAGG + Intronic
915698966 1:157772647-157772669 ACAGCTAATAATAGTAGACTTGG - Intronic
916305056 1:163321219-163321241 GAAGCTAAAATCAGGAGACCTGG + Intronic
918250753 1:182700939-182700961 GAAGCTTAGAATATTGGACTGGG - Intergenic
919267460 1:195289052-195289074 TAAGCAAAGAGTAGGAAACTTGG - Intergenic
920498827 1:206473581-206473603 GAATCTAGGAATAGCAGAGTGGG + Intronic
921886682 1:220314211-220314233 GAAGCAATGAATAAAAGACTGGG - Intergenic
922383125 1:225053367-225053389 GAAGCTAAGAAATGGAGAAAAGG + Intronic
923222101 1:231904679-231904701 GAAGCCAAGAATTGGATTCTAGG - Intronic
1063173420 10:3530090-3530112 GAAGCTAAGAAGTGGAACCTTGG - Intergenic
1064275675 10:13902908-13902930 CAAGCTAAGAATCAGAGACCTGG - Intronic
1064419656 10:15179877-15179899 GGAGGTAAGATTAGGAGGCTTGG + Intergenic
1066407798 10:35135674-35135696 GAAGCTAGGAATTTGAGACCTGG + Intronic
1069726960 10:70586291-70586313 GAAGCTAAGAATAGGTGGCCTGG - Intergenic
1069907504 10:71740444-71740466 GAAGCTAAAGACAGGAGCCTTGG + Intronic
1070945224 10:80385421-80385443 GAAGCCAGGAATTGGAGACCAGG - Intergenic
1072206180 10:93207131-93207153 GAAGCAATGAATAAAAGACTGGG - Intergenic
1073835113 10:107432203-107432225 GCAGCAATGAATAGGAGTCTTGG - Intergenic
1073994178 10:109296238-109296260 GAGGCTAAGAACAGAAGCCTTGG + Intergenic
1074550705 10:114439534-114439556 GAAACTAACAATAATAGACTTGG - Intronic
1076225211 10:128769293-128769315 GTAGCCAAGAATAGGAAAATGGG + Intergenic
1078282635 11:9918298-9918320 AAAGCTAAAAATAGGAGGATGGG - Intronic
1081276475 11:41155662-41155684 TAACTTAAGAATAGGAGAGTAGG - Intronic
1081940230 11:46935445-46935467 GACGCTAAGAATAGGCCACTCGG + Intergenic
1085453801 11:76654743-76654765 GAAGAGAAGAATGGGAGACGAGG + Intergenic
1085834098 11:79934049-79934071 GAAACTGAGAAAAGGAGAATAGG - Intergenic
1086596055 11:88572200-88572222 GAAGCTGAAAATAAGAGACATGG + Intronic
1086764328 11:90675859-90675881 GAAGTTAAGAATAGGGGTTTGGG + Intergenic
1090083774 11:123633124-123633146 GAAGACAAGGACAGGAGACTTGG - Exonic
1090125883 11:124083619-124083641 GAAGCTAAGGGTGGGAGAATAGG - Intergenic
1090396288 11:126421294-126421316 GAACCTGAGAATTAGAGACTGGG + Intronic
1091683017 12:2540365-2540387 GGAGCTCAGAAGAGGAGACTCGG + Intronic
1092719563 12:11427567-11427589 GAAGCTCAGAGTAGGAGTCTTGG - Intronic
1095479014 12:42614310-42614332 GAAGGAGAGAACAGGAGACTTGG + Intergenic
1095520561 12:43059507-43059529 GAAGCTAATAATAAAAGATTAGG + Intergenic
1095521442 12:43071592-43071614 GAAGCTGATTATAGGAAACTGGG + Intergenic
1098843015 12:75499879-75499901 AAAGCAAAGAATAAGAAACTGGG - Exonic
1099954277 12:89337649-89337671 GAAGTCAAGAGTTGGAGACTAGG + Intergenic
1100845062 12:98649916-98649938 GAAGGTAGGGATGGGAGACTAGG + Intronic
1101599333 12:106195402-106195424 GAAAATTAGAATAGGAGAGTGGG - Intergenic
1102760538 12:115380987-115381009 GAAGCTAAGACTAGGAACCTGGG - Intergenic
1108073612 13:46655750-46655772 GAATCTAAGAATAGGGACCTTGG + Intronic
1109294450 13:60513091-60513113 GAAGTTAAGAATTGGGGATTGGG - Intronic
1109371683 13:61428870-61428892 AAAGCTAAGAATTGGACACGAGG - Intergenic
1110677902 13:78271643-78271665 TAAGCTCAGAAGAGGAGAATTGG + Intergenic
1112730322 13:102353423-102353445 GAAGCTTAGAAGAGGGGCCTAGG - Intronic
1112847120 13:103657418-103657440 GAAAATAACAATAGGAGAATAGG - Intergenic
1112888504 13:104204148-104204170 GAAGCAAAGAAAAGTACACTTGG + Intergenic
1115072273 14:29338347-29338369 GAAGAAAGGAAAAGGAGACTAGG + Intergenic
1115213863 14:30995437-30995459 GAAGCTAAGAACAAGAGAGAGGG - Intronic
1115527724 14:34298256-34298278 GAAGCAAAGAAAAGTACACTTGG - Intronic
1117089151 14:52232532-52232554 GTAGCCAAGAAGAGGAGACTAGG + Intergenic
1120764351 14:88315061-88315083 GGAGCTTAGGATAGGAGACCTGG - Intronic
1124460970 15:29891291-29891313 GAATCTCAGAATTGGAGAGTAGG - Intronic
1125122546 15:36179436-36179458 GAAGCCAAGCATAGGATACCAGG + Intergenic
1128705470 15:69834818-69834840 GAAGCTGAGAAGCTGAGACTGGG + Intergenic
1129545785 15:76393506-76393528 GCAGCTGAGAACAGGAGACTGGG + Intronic
1131329082 15:91479719-91479741 GAAGCTAAGAAAAGGAAAGGTGG - Intergenic
1132470934 16:102621-102643 GGAGCTGAGAATAGCAGAATAGG - Intronic
1133741822 16:8657679-8657701 GAACCTATGAATGGGAAACTTGG + Intergenic
1136531076 16:30869724-30869746 GAGGCTAAGAGTTGGAGACCAGG - Intronic
1137407285 16:48199596-48199618 CAATCTAAGAATGGGAGACTTGG + Intronic
1137983257 16:53087405-53087427 TAAGCTGTGAATATGAGACTCGG + Intronic
1138548956 16:57736589-57736611 GAAGCTAAGCTTAGGGGCCTAGG - Intronic
1141009327 16:80382606-80382628 GAAATGAAGAATTGGAGACTGGG - Intergenic
1141268550 16:82518828-82518850 GAATCTAAGAAGAAGAGCCTAGG + Intergenic
1141473214 16:84253360-84253382 GGAGATGAGAATAGGAGTCTTGG + Intergenic
1141594942 16:85091621-85091643 GAAGGAAAGAAGACGAGACTTGG - Exonic
1143229707 17:5342762-5342784 GAAGACAAGATGAGGAGACTTGG + Intronic
1148125083 17:45232275-45232297 GGAGCTGAGAATGGGACACTGGG + Intronic
1150091786 17:62332760-62332782 AAAGAAAAGAAGAGGAGACTGGG + Intergenic
1150157930 17:62869653-62869675 TATGCTATGAATAGGACACTTGG - Intergenic
1150738334 17:67759326-67759348 GAAGCAAAGAAAGGGAGGCTTGG - Intergenic
1151947757 17:77328840-77328862 GAAGCTAAGAACAGGTTGCTGGG + Intronic
1153596005 18:6725867-6725889 GAAGATGAGACTGGGAGACTAGG - Intergenic
1155881518 18:31155027-31155049 GAAAGAAAGAATAGGAGAGTAGG - Intronic
1168629584 19:57946767-57946789 GAAGCAAAGAACAGGAGGATAGG - Intronic
926937536 2:18101382-18101404 GAAGGTAAGATTGGCAGACTGGG + Intronic
927043627 2:19254927-19254949 CATGGTAAGAATGGGAGACTGGG - Intergenic
929070815 2:38028995-38029017 AAGGCAAAGAACAGGAGACTGGG + Intronic
929347830 2:40908202-40908224 AAAGAAAAGAAAAGGAGACTTGG - Intergenic
931257680 2:60587692-60587714 TTAGCTATGCATAGGAGACTGGG + Intergenic
932475822 2:72005197-72005219 GAAGCAAAGAAGAGGTGCCTGGG + Intergenic
932722805 2:74150146-74150168 GAAGATAAGAGGAGGAGAATGGG - Intergenic
933174538 2:79160192-79160214 GAAGCTAAGAGTAGGAGTGAGGG + Intergenic
939000673 2:136730304-136730326 GAAGCTAAGAAAAAGTGACAAGG + Intergenic
942184670 2:173413733-173413755 GAGGAAAAGAAAAGGAGACTGGG - Intergenic
942612819 2:177759383-177759405 GAAGTGAAGAATGTGAGACTGGG - Intronic
945525221 2:210880401-210880423 AAAGCTAAGACTGGGAGATTTGG - Intergenic
945718550 2:213388362-213388384 GAAGGTGGGAAAAGGAGACTTGG - Intronic
945944329 2:215980422-215980444 AAAGGAAAGAACAGGAGACTGGG - Intronic
946243491 2:218371464-218371486 GAGGCCAGGAATAGGAGACTGGG + Intergenic
947704568 2:232263807-232263829 GGAGGCAAGAATAGGAGACACGG + Intronic
1170500187 20:16967868-16967890 GAAGCAAAGAAAAGTACACTTGG + Intergenic
1172084101 20:32365296-32365318 GAAGCAAAGAATAGGACCATGGG + Intronic
1173151816 20:40572656-40572678 AATGCTAAGAATATGAGAATGGG - Intergenic
1175536598 20:59719149-59719171 AAAGCTAAGAATAAGAGAAAGGG - Intronic
1175967123 20:62665340-62665362 GAAGCCAAGACTAGGTGGCTAGG - Intronic
1176980824 21:15378872-15378894 AAAGCTATGAATAGGCAACTGGG - Intergenic
1177540409 21:22485570-22485592 GAAGAAAAGAAAAGGAGGCTGGG - Intergenic
1177945075 21:27457406-27457428 GAAACTTAGAATAGGATACTTGG + Intergenic
1179322398 21:40304763-40304785 GAAGCTGAGAAATGGAGACTGGG + Intronic
1183999392 22:41661342-41661364 GAAGCAATGAATAAAAGACTGGG + Exonic
1184183981 22:42851565-42851587 GGAGCTAACAAGTGGAGACTGGG + Intronic
951455799 3:22890874-22890896 GAAGGTAATAAAAGGAGACTTGG - Intergenic
951987983 3:28642201-28642223 CTAGCTAAGACTAAGAGACTTGG - Intergenic
952736606 3:36697456-36697478 GAAGCTAAGCCAAGGAGATTGGG + Intergenic
953243943 3:41174085-41174107 GAAGCTAAGAGGAAGAGAGTTGG + Intergenic
953367731 3:42360384-42360406 GAAGCTAAGATTTGGGGACTTGG + Intergenic
954087752 3:48259276-48259298 TGAGCTAAGAGTAGGAAACTAGG - Intronic
954245672 3:49329612-49329634 GAACCCAGGAATTGGAGACTAGG - Intronic
955522853 3:59791921-59791943 GCAGCTAAGAATAAGACAGTGGG + Intronic
955785684 3:62536210-62536232 GAAGCTAAGATAGGGAGGCTGGG + Intronic
956299698 3:67758490-67758512 TAAGTTAAGCACAGGAGACTTGG + Intergenic
957246450 3:77722583-77722605 GAAGCTCATAATAGCAAACTTGG + Intergenic
958022526 3:88015366-88015388 GAAGCTTAGAAGAGGAGAATGGG - Intergenic
959031258 3:101301489-101301511 GAAGCCAAGGATAGGGGTCTGGG - Intronic
959421003 3:106128284-106128306 GAAGCTCAGAAGAGGAGTCTTGG - Intergenic
960939234 3:122922631-122922653 GGAACTAAGAACAGGAGACTGGG + Intronic
962900122 3:139754578-139754600 AAAGCTGGGAAGAGGAGACTTGG - Intergenic
963553325 3:146753131-146753153 GAAGATAGGAACTGGAGACTAGG + Intergenic
964167437 3:153725573-153725595 GAGGACAAGAATAGGAGACAAGG - Intergenic
966039349 3:175462155-175462177 GATGTTAATAATAGGAGGCTTGG + Intronic
968942855 4:3648115-3648137 AAAGCTAAGAATTCAAGACTAGG - Intergenic
970668976 4:18374383-18374405 GAAGAGAGGAATGGGAGACTGGG - Intergenic
971854845 4:32030046-32030068 GAAGGTTCTAATAGGAGACTGGG - Intergenic
975720226 4:77242097-77242119 GAAGAAAAGAATAGGTGAATAGG + Intronic
976319846 4:83701616-83701638 GAAGATTAGAATAGGAGAAATGG - Intergenic
977961399 4:103089146-103089168 GAAGCTAGGATTTGGAGTCTAGG - Intronic
978300730 4:107266992-107267014 GAAGCCAAGTCTAGGAGCCTAGG + Intronic
980166745 4:129237815-129237837 CAAGCTAGGAATCAGAGACTGGG - Intergenic
980246610 4:130253349-130253371 AAGGGTAAGAATAGGAGAATAGG + Intergenic
980450634 4:132966078-132966100 GTAGCTAAAAATAGCAGTCTCGG - Intergenic
982698098 4:158627306-158627328 TAAGCTGTGAATAGGAGAGTTGG - Intronic
985167425 4:187111771-187111793 GAAGCAAAGAATTGGAGAAATGG - Intergenic
985625518 5:983249-983271 GAGGCTCAGAATTGGAGTCTGGG + Intergenic
986220878 5:5767485-5767507 GAAGCCAAGAAGAGGTGGCTGGG - Intergenic
987328132 5:16831053-16831075 GAAGCTGAGTAAAGGAGACATGG + Intronic
987553579 5:19415620-19415642 GATGCTGAGGAGAGGAGACTGGG + Intergenic
988153587 5:27419382-27419404 GAAGCTGGGAATAGTAGCCTTGG - Intergenic
990943191 5:61224653-61224675 AAAGCAAAGAATAGGAAACTGGG - Intergenic
991673029 5:69065976-69065998 GAAGTTAAAAATAGGAGGCCGGG - Intergenic
993106061 5:83602283-83602305 GAAGCTTAGAAGTGGAGCCTGGG - Intergenic
995446977 5:112255261-112255283 GAAGATAAGAATTGGAGATTTGG - Intronic
996421952 5:123271989-123272011 GGAGCTCAGAAGAGAAGACTGGG + Intergenic
996541297 5:124632115-124632137 GAAGCTCAGAATACAAGAGTTGG - Intergenic
996899048 5:128522400-128522422 GAAGCTAAGAATCAGAGAGGTGG - Intronic
996973554 5:129402610-129402632 GAAGCTAATAATTGGAGTATAGG + Intergenic
998041007 5:138951131-138951153 AAAGCAAACAAGAGGAGACTGGG + Intronic
998173825 5:139888054-139888076 GAAGTGAAGCATGGGAGACTGGG - Intronic
998981097 5:147703069-147703091 GAAGAAAAGTATAGGAGACCTGG - Intronic
999315995 5:150584576-150584598 GAAGCTAACGAAAGGAGGCTTGG - Intergenic
1001800922 5:174543381-174543403 GAAGCTAAGATTCGGAAACTGGG + Intergenic
1003693953 6:8383556-8383578 GAAGCTCAGAATAGGAGAATTGG - Intergenic
1003994211 6:11522553-11522575 GAAGCTAAGAACAGAGGACACGG + Intergenic
1004498795 6:16190191-16190213 GGAGCTAAGAATTGGAAACCAGG - Intergenic
1005674644 6:28141555-28141577 GGAGCTGTGAATAGGAGGCTGGG - Intergenic
1006522512 6:34579523-34579545 GAAGATAAGAAAAGGGGAGTTGG - Intergenic
1007911934 6:45524399-45524421 GCAGCGAAGCATGGGAGACTAGG + Intronic
1009555335 6:65156810-65156832 GAAGCAAAGAATGGGAGGCCAGG - Intronic
1009784325 6:68313156-68313178 GAAAATTAGAATAAGAGACTTGG - Intergenic
1011811774 6:91140450-91140472 ATAGCTAAGAAAAGGAGATTAGG - Intergenic
1013585678 6:111576513-111576535 GAAGCTGGTAATAGGACACTGGG - Intronic
1013975536 6:116074195-116074217 AAAGCTAAAACCAGGAGACTGGG + Intergenic
1014141736 6:117951696-117951718 TATGCTAAGGATAAGAGACTGGG + Intronic
1014512486 6:122341355-122341377 GAAGCTGAAAAGAGGAGTCTTGG - Intergenic
1014665351 6:124230722-124230744 GAAGTTAAGAATTGGAGTTTGGG + Intronic
1014683830 6:124469864-124469886 GAAGATAAGAAGAGGTGACGGGG - Intronic
1015300399 6:131646602-131646624 AAAGCTAAATATAGGAGAATTGG - Intronic
1015351308 6:132223544-132223566 GAATTTAAGAAAAGGTGACTGGG + Intergenic
1015484064 6:133748202-133748224 AAAGCAAAGAATAGAACACTGGG - Intergenic
1017281672 6:152632480-152632502 GAAGGTAATAAAAGGAGACTGGG + Intronic
1021709783 7:23404256-23404278 TGAGCTAAGAATATGAGAGTAGG + Intronic
1022682278 7:32560108-32560130 GAGGCTGAGATTAGGAGGCTTGG + Intronic
1023206293 7:37753553-37753575 AAGGCTAAGAATAGGAGTCAGGG + Intronic
1023457547 7:40357993-40358015 GCACATAAGAATAGGAGACTTGG + Intronic
1026154190 7:67812909-67812931 GAAGCTAGGAGCAGGAGGCTGGG - Intergenic
1027714615 7:81654387-81654409 TAAGCTAAGAATAGCTCACTAGG - Intergenic
1030629835 7:111883672-111883694 GTATCTATGAATAGAAGACTTGG + Intronic
1030920060 7:115372613-115372635 GAAGCTAGGAGTTTGAGACTGGG + Intergenic
1031016955 7:116585777-116585799 GAAGTCAAGAAGAGGAAACTCGG - Intergenic
1032607255 7:133369241-133369263 GCAGCAAAGAATAAGAGATTAGG - Intronic
1036187628 8:6637965-6637987 GAAGCTCAGAACACAAGACTAGG - Intronic
1037821581 8:22137669-22137691 GAAGCTAGGCAGAGGAGACCTGG - Intergenic
1038742954 8:30231722-30231744 GGAACTAAGAATTGGAGACTGGG - Intergenic
1039018859 8:33183360-33183382 GAAGCAAAGAAAAGTACACTTGG - Intergenic
1039088713 8:33805597-33805619 CATGCAAAGAATAGGATACTGGG + Intergenic
1042290205 8:67163008-67163030 GAGGCTGAGAATAGAATACTGGG + Intronic
1042481365 8:69307376-69307398 GAACATAAGAAGAGGTGACTGGG + Intergenic
1043559968 8:81481152-81481174 GAAGCACAGAAAAGTAGACTTGG - Intronic
1044263591 8:90156721-90156743 GTAGCCAAGAAGAGGAGACAAGG + Intergenic
1045215748 8:100146638-100146660 GAAGCCAGAAAAAGGAGACTAGG - Intergenic
1045821322 8:106342102-106342124 GAAGCTAAGAGTTTGAGACCAGG - Intronic
1046860796 8:119089233-119089255 GAAGCTAAGAATAGGAGACTAGG - Intronic
1048869993 8:138789417-138789439 CAGGCTAAGAATAGGAGATGGGG + Intronic
1048918849 8:139209639-139209661 CAGGCTAAGAATAGGAGATGGGG + Intergenic
1050365861 9:4873262-4873284 TGAGCTAAGAATAGGAGAGGCGG + Intronic
1053247277 9:36544921-36544943 GAATTTTAAAATAGGAGACTTGG - Intergenic
1055779586 9:79805400-79805422 ACAGCTAAGATTAGGAGATTTGG + Intergenic
1056072647 9:83005083-83005105 GATGCTCAGAATGGGAGCCTTGG - Intronic
1057487193 9:95494873-95494895 GAAGCTGAGAGAAGGAAACTGGG - Intronic
1057958011 9:99426887-99426909 GAAGCCAATAATAAGAGACAAGG - Intergenic
1059820701 9:117969191-117969213 GAACCTAAGAAGAGGTGATTAGG - Intergenic
1060137809 9:121174188-121174210 GCAGCCAAAAATAGGAGTCTAGG + Intronic
1060594736 9:124841199-124841221 GAAAATAAGAATTAGAGACTTGG - Intergenic
1187187080 X:16997349-16997371 GAAGGAAAGAACAGTAGACTCGG - Intronic
1187238990 X:17495619-17495641 GAAGATAAGGATATGAGGCTAGG + Intronic
1187558593 X:20377367-20377389 TAAGCTCTGAATAGGAGTCTAGG - Intergenic
1188885153 X:35540699-35540721 GGAGCTGAGAATAAGAGAGTGGG - Intergenic
1189051860 X:37653750-37653772 TAAGCTAAGGAAAGAAGACTTGG + Intronic
1189635518 X:43004418-43004440 GGAGCTCAGAACAAGAGACTTGG + Intergenic
1190936127 X:55000662-55000684 GACTCTAAGAATAGGAAACTGGG - Intronic
1192272826 X:69599510-69599532 GAACCTAATAAGAGGTGACTAGG - Intergenic
1192745369 X:73933225-73933247 GAAAGTAAGAATAGTAGGCTGGG + Intergenic
1193907966 X:87265380-87265402 GAAGCAAAGAAAAGTACACTTGG + Intergenic
1195402841 X:104480095-104480117 GAAGCTATGTTTGGGAGACTAGG + Intergenic
1195712703 X:107786947-107786969 GAAACTAAGATTGGGAAACTAGG + Intronic
1196252058 X:113472833-113472855 GAAGATAAGAATAGAAAACAAGG - Intergenic
1199681968 X:150231345-150231367 GAAGCAATAAATAGAAGACTGGG - Intergenic
1199843645 X:151675284-151675306 GAAGCTAAGAAGAGGAGCTCGGG - Intronic
1201281780 Y:12348891-12348913 AAAACCAAGAATCGGAGACTAGG - Intergenic