ID: 1046860798

View in Genome Browser
Species Human (GRCh38)
Location 8:119089241-119089263
Sequence TGACCTAGGAAGCTAAGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046860798_1046860800 -8 Left 1046860798 8:119089241-119089263 CCTATTCTTAGCTTCCTAGGTCA 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1046860800 8:119089256-119089278 CTAGGTCATGCCTACAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046860798 Original CRISPR TGACCTAGGAAGCTAAGAAT AGG (reversed) Intronic
902172073 1:14620013-14620035 TGACCTGGGGAGCTGAGAAGAGG - Intronic
903307608 1:22424241-22424263 TTTCCTAGGAAGCAAAGCATGGG - Intergenic
906811049 1:48827390-48827412 TGACCTGGGAAGCTAGGGAGAGG - Intronic
909130775 1:71734103-71734125 TTACCTAGGACCCTAAGGATAGG + Intronic
910098460 1:83551140-83551162 TGACCTAGAAAGCAAAGATCAGG + Intergenic
910419607 1:87044216-87044238 TCAACTAGAAAGCTAAGAACTGG - Intronic
911215343 1:95187202-95187224 TGATCTATGACGCTAACAATAGG - Intronic
911450716 1:98056940-98056962 TGACCCAGAAAGCTAAGACATGG - Intergenic
913232067 1:116748169-116748191 AGACCAAGGAAGCTTAGAAGAGG - Intergenic
916413800 1:164574475-164574497 TGTCCTAGGAATCTAAGCTTTGG - Intronic
916420660 1:164634920-164634942 TCACCTATGATGCTAAGAATAGG - Intronic
920748427 1:208651094-208651116 TGACATAGCAAGCGAAGGATGGG - Intergenic
921754885 1:218843549-218843571 TGAAATAGAAAGCTAAGAAGTGG + Intergenic
921971276 1:221151876-221151898 TGACCTATGAGGATATGAATAGG - Intergenic
923844715 1:237716992-237717014 TGACCTAGGAATCTGAGGGTAGG + Intronic
1066307768 10:34163194-34163216 TCACCTAGGAAGTTAAGTCTTGG + Intronic
1066523403 10:36248365-36248387 TGACCTGTGAAACAAAGAATTGG - Intergenic
1066601302 10:37110471-37110493 TGAGCCAGGAAGATAAGCATTGG + Intergenic
1068815140 10:61301231-61301253 TGACTTTTGAAGCAAAGAATAGG - Intergenic
1071488447 10:86119439-86119461 TGATGTAAGAAGCTAAAAATGGG + Intronic
1072632031 10:97153082-97153104 TGACCTAGGAATCTCATATTTGG - Exonic
1072839922 10:98761280-98761302 AGATCAAGGAAGCTAAGAGTTGG + Intronic
1073313505 10:102561585-102561607 TGGCCAAGGAACCTAAGAAGGGG - Intronic
1073456739 10:103641410-103641432 TGCCTTAGGAAACTCAGAATGGG + Intronic
1073550951 10:104400661-104400683 TGACCTAGGAAGGTAGGGAGGGG - Exonic
1073907837 10:108304661-108304683 TTACCTAGCAATATAAGAATGGG + Intergenic
1074260145 10:111845360-111845382 TGACCTAGGAAGACAATATTTGG - Intergenic
1074329838 10:112494961-112494983 AGGCTTGGGAAGCTAAGAATCGG + Intronic
1075960520 10:126563893-126563915 TGACCACGGAAGCTGAGAACAGG + Intronic
1077693206 11:4368181-4368203 TGACATAGGAAATGAAGAATGGG + Exonic
1078605172 11:12768892-12768914 CGACCTTGGTAGCCAAGAATAGG - Intronic
1080473351 11:32567481-32567503 TGAGCTATCAAGCTATGAATAGG - Intergenic
1082208245 11:49464758-49464780 AGATCAATGAAGCTAAGAATTGG + Intergenic
1083160385 11:60850672-60850694 GGACCTAGGATGCTGAGAAAGGG - Exonic
1085889527 11:80561436-80561458 TGAGCCAGGAAGATAAGCATTGG + Intergenic
1086132193 11:83412516-83412538 TGCCCTAGGAAGCTGGTAATAGG - Intergenic
1089260133 11:117218532-117218554 TGACGTAGGATGCTAAGTAAGGG + Exonic
1091400837 12:179677-179699 TGACCTGGGAAGCTGAGGACTGG + Intergenic
1092042962 12:5401574-5401596 TGACTTAGGACGCTTAAAATTGG + Intergenic
1097911065 12:64969588-64969610 TGACCTAGGAAGTTGAGAGCTGG + Intergenic
1099279981 12:80631531-80631553 AGATCTAGGAAGCTAACAAAAGG - Intronic
1099439117 12:82680413-82680435 TGACCTATTAATCTAATAATAGG - Intergenic
1099994757 12:89766256-89766278 TGACCTAGGTAGCTATGTAAAGG + Intergenic
1100201560 12:92304329-92304351 TGGCCTAACAAGCTGAGAATGGG + Intergenic
1107671228 13:42748362-42748384 GGACCTAGAAATCTAAGATTAGG + Intergenic
1108271932 13:48770198-48770220 TGGCCTTTGAAGCTAGGAATTGG - Intergenic
1109371684 13:61428878-61428900 TGACACTGAAAGCTAAGAATTGG - Intergenic
1110266469 13:73543167-73543189 TGACCTAGGAAGCTCTGATGAGG - Intergenic
1111395316 13:87660406-87660428 TGACCAAGGAAGCAGAAAATTGG + Intergenic
1117000240 14:51364570-51364592 TGAAATAGGAAACTAAGAACTGG + Intergenic
1121809708 14:96873176-96873198 TGACTTGGGAAGCAAAGAATTGG + Intronic
1125139681 15:36390213-36390235 TGTCATAGGAAGCTGGGAATAGG - Intergenic
1126499982 15:49334896-49334918 TGTGCTAGGAAGCTAGGAATGGG - Intronic
1129261762 15:74372467-74372489 TGCCCTGGGTAGCTAAGATTAGG - Intergenic
1130859597 15:87874721-87874743 TGATCTGGGTAGCTAAGAACAGG - Intronic
1131329084 15:91479727-91479749 AGAACAAGGAAGCTAAGAAAAGG - Intergenic
1131540913 15:93274599-93274621 TTGCCTAGGAAGCAAAGAATTGG - Intergenic
1131574208 15:93570275-93570297 TGATAAAGGAAGCTAAGCATAGG + Intergenic
1134273126 16:12751945-12751967 TGTGCTAGGAAGCTCTGAATAGG + Intronic
1140454556 16:75097424-75097446 TGACATAAGAAGCTGAGCATGGG - Intronic
1145011815 17:19372583-19372605 GGCCCTGGGGAGCTAAGAATGGG - Intronic
1146536637 17:33658278-33658300 TGAGCCAGGAAGCGAAGCATAGG + Intronic
1155541509 18:26873255-26873277 TGACCTAAGAAGGTGACAATGGG - Intergenic
1156093542 18:33500843-33500865 TGAACTAGCAATTTAAGAATGGG + Intergenic
1158662720 18:59403359-59403381 GGACCTAGGAAGCTCATGATTGG + Intergenic
1159942408 18:74418509-74418531 TGACCCAGGAAGAAAAGCATGGG - Intergenic
1162494699 19:11017199-11017221 TGTCCACGGAAGCTGAGAATGGG - Intronic
1163870026 19:19813526-19813548 TGACCCAGGAACCTCATAATTGG + Intronic
1163921091 19:20289226-20289248 TGACCCAGGAATCTTATAATTGG - Intergenic
1163957379 19:20656922-20656944 TGACCCAGGAATCTCATAATTGG + Intronic
1163959326 19:20672589-20672611 TGACCCAGGAACCTCATAATTGG - Intronic
1164970245 19:32525990-32526012 AGACTTTGGAGGCTAAGAATGGG - Intergenic
1165918298 19:39275235-39275257 TGACCTATGCAGCCAGGAATGGG + Intergenic
925243954 2:2362477-2362499 TGACCTAGGAATTCAAGAAAGGG - Intergenic
927759674 2:25741613-25741635 TTTCCTAGGAAGCTAGGAAAAGG - Intronic
929071963 2:38039791-38039813 TGACCCAGGATGTCAAGAATCGG + Intronic
929898639 2:45983056-45983078 TAAGCTAGGCATCTAAGAATGGG + Intronic
929910750 2:46087517-46087539 TGACTAAGGAAGCTAAGAGATGG - Intronic
935918616 2:107986109-107986131 TGACCTGGGAAGAAAAGAACAGG + Intergenic
936433803 2:112485898-112485920 TGACCTAGGAAGGAAAGAGGAGG - Exonic
937576763 2:123432914-123432936 TCAACTAGGCAGTTAAGAATAGG + Intergenic
938451784 2:131427330-131427352 TGAACTGGGAAGGTAAGGATTGG - Intergenic
939100886 2:137893842-137893864 TAACCTAGGAAGGAAAGAAATGG - Intergenic
940947661 2:159636689-159636711 TGACCTAGGAAGATACTAGTTGG + Intergenic
943537146 2:189166845-189166867 TGTCCTAGGACGCTAACTATAGG + Intronic
944878783 2:203990017-203990039 TGTTCTAGAAATCTAAGAATTGG - Intergenic
945675649 2:212852451-212852473 TGACCTATGAAGCCAAAAAGTGG - Intergenic
947910832 2:233799695-233799717 TGACATAGAGAGCTAGGAATTGG - Intronic
947948754 2:234129508-234129530 TCACCTAGGAAGAGAAAAATAGG + Intergenic
948000755 2:234565201-234565223 GCATCTAGGAAGGTAAGAATTGG + Intergenic
948485129 2:238275922-238275944 ACACCTAGGAAGCTAACATTTGG - Intronic
1174027015 20:47585590-47585612 TGGCCTCGGAAGCTAAAATTAGG - Intronic
1174195172 20:48767721-48767743 TGACCTAGGAAGGGCAGACTAGG - Intronic
1174446212 20:50593024-50593046 TCACCAAGGAAGGTAAGACTGGG - Exonic
1177196064 21:17904801-17904823 TGGCCTTGGAAGCTAGGGATTGG + Intronic
1178175214 21:30089271-30089293 TGACCTTGCAAGTTAAAAATAGG + Intergenic
949510739 3:4764687-4764709 AGAGCTAGGAATATAAGAATAGG + Intronic
951277528 3:20706842-20706864 TGACATAGAAAGGTAATAATTGG - Intergenic
951817721 3:26773137-26773159 TGAACTATGAAGATAAGATTTGG - Intergenic
953226248 3:41024322-41024344 TGACCTATGAACCTGAGACTTGG + Intergenic
956319151 3:67976104-67976126 GGACCTGGGAAGAAAAGAATGGG - Intergenic
957136913 3:76300042-76300064 TGACCTAGAAAGCTAATTATTGG - Intronic
958004976 3:87798932-87798954 TGAACAAGAGAGCTAAGAATGGG - Intergenic
958430776 3:94038342-94038364 GAACCTAGGAAGCCAAGATTTGG - Intronic
960441219 3:117691447-117691469 TGCCCTAGGAATCCAAGAATTGG - Intergenic
961907189 3:130275300-130275322 GGACATAGGAAGGGAAGAATGGG - Intergenic
962132909 3:132701710-132701732 TGAACTAGTAAACTAAGAATGGG + Intronic
963398544 3:144765774-144765796 TGTTCTAGGAAGCTAACAATAGG + Intergenic
963398583 3:144766618-144766640 TGTTCTAGGAAGCTAACAATAGG - Intergenic
964716482 3:159728061-159728083 TGCCCTGGGGAGCTAACAATGGG - Intronic
965467750 3:169053497-169053519 TGACCAAGGAGGATAAGGATAGG - Intergenic
970226541 4:13864182-13864204 TGAAATAGAAAGGTAAGAATTGG - Intergenic
970566889 4:17340344-17340366 TGATCTTGAAAGCAAAGAATAGG + Intergenic
971867658 4:32192879-32192901 AGACCCTGGAAGCTAAAAATTGG + Intergenic
975447141 4:74479115-74479137 TGAACTGGCAAGCAAAGAATTGG + Intergenic
975578308 4:75884860-75884882 AGACCTAGAAAGCACAGAATTGG - Intronic
976253590 4:83077959-83077981 AGATCCAGGAAGCTAAGAAAAGG + Intergenic
977602275 4:98946720-98946742 TGGCCTAGGAAACAAAGATTTGG + Intergenic
979949758 4:126877553-126877575 TGTCCTGGGCAGCTAAGGATGGG - Intergenic
980510587 4:133781469-133781491 TGACCTTGGATGCGAAGAAGAGG + Intergenic
981143422 4:141297564-141297586 TAACCTGGAAAGCCAAGAATTGG - Intergenic
982023761 4:151231839-151231861 TTACCCAGGAAGGGAAGAATTGG + Intronic
988435408 5:31168521-31168543 TGAGCTATGAAGCTATGAAAAGG - Intergenic
990570383 5:57072635-57072657 TGACCTGGGATGGAAAGAATGGG + Intergenic
992237244 5:74723500-74723522 TGACCTAGGATGCCAGCAATAGG - Intronic
992760260 5:79945084-79945106 TGCCCTAGCAAGGGAAGAATTGG + Intergenic
992760604 5:79948187-79948209 TGCCCTAGCAAGGGAAGAATTGG + Intergenic
994354570 5:98780618-98780640 TGACCGAGGAGGTTAATAATTGG + Intronic
995044053 5:107623395-107623417 TAACCCAGGAAGCTGAAAATAGG - Intronic
995320625 5:110829964-110829986 AGACCAAGGAAGCTAACAAAAGG + Intergenic
998095415 5:139393462-139393484 TTACTCAGGAAGCTCAGAATGGG - Exonic
999173430 5:149614781-149614803 TCAGCCATGAAGCTAAGAATAGG - Intronic
1000559478 5:162768002-162768024 TGACCTAGGAAATTAGGAACAGG - Intergenic
1003332819 6:5143978-5144000 AGACCTCAGAAGCTTAGAATTGG - Intronic
1003384801 6:5657396-5657418 TGACCAATCAAGCTTAGAATAGG + Intronic
1008529293 6:52440649-52440671 TGACCTAGGAATCTCATTATTGG - Intronic
1010256142 6:73760543-73760565 TGACTTACGAAGCTAAGTTTGGG + Intronic
1010947744 6:81998113-81998135 TGACCTAGAAAACTAATAAAGGG - Intergenic
1011958986 6:93062717-93062739 TGAGCTAGGAACCAGAGAATAGG + Intergenic
1016004980 6:139079980-139080002 ACACCTAGGAAGCTGAGAACAGG + Intergenic
1016147281 6:140692388-140692410 TGACAGAGGAAGAGAAGAATAGG - Intergenic
1018336184 6:162792396-162792418 TGAGCTAGAAAGATAAGAAATGG + Intronic
1020396764 7:7725835-7725857 TGACGTAGGAAGAGAAGACTAGG + Intronic
1020450696 7:8317392-8317414 TGACTAAGGAAGAGAAGAATTGG - Intergenic
1021679081 7:23111410-23111432 TGACTTATGAAGCTATGCATGGG - Intronic
1022806795 7:33830637-33830659 TGACATAGGGTGATAAGAATAGG + Intergenic
1025148308 7:56524258-56524280 CTACCTAGGAGGCTAAGAAGGGG - Intergenic
1026102663 7:67395761-67395783 TCACTTATGAAGCAAAGAATGGG - Intergenic
1028075922 7:86515075-86515097 TGACCTAAGAAGCTATGGCTTGG - Intergenic
1032057833 7:128697728-128697750 TGATCTCGGAAGCTAAGATGTGG + Intergenic
1033731846 7:144187939-144187961 TGACCTGGGAAGCGAAGAAGAGG - Exonic
1033742694 7:144286522-144286544 TGACCTGGGAGGCGAAGAAGAGG - Intergenic
1033751207 7:144363092-144363114 TGACCTGGGAAGCGAAGAAGAGG + Exonic
1035295036 7:157862248-157862270 GGACCTCGGCAGCTCAGAATGGG - Intronic
1036521196 8:9493247-9493269 CGACTCAGGAAGCTAAGAGTTGG + Intergenic
1039562909 8:38527507-38527529 GGACCTAGAGACCTAAGAATGGG + Intronic
1039646522 8:39290306-39290328 TGACCTACGAAGGTAAGCAGTGG - Intergenic
1039754173 8:40505530-40505552 TGACACAGGAAGCTAAAAGTTGG + Intergenic
1042175489 8:66033957-66033979 TGACCTGGGATGCTCAGAATTGG + Intronic
1045271680 8:100667471-100667493 TGACTTAGAAACCTAAGAAACGG + Intergenic
1045459912 8:102416484-102416506 AGTCCTAGGAAACTAGGAATGGG - Intergenic
1046860798 8:119089241-119089263 TGACCTAGGAAGCTAAGAATAGG - Intronic
1048267004 8:132996272-132996294 TCACATAGGAAGCAAATAATGGG - Intronic
1048852366 8:138657320-138657342 TCCCCTAGGAAGTTAATAATAGG + Intronic
1051010443 9:12406541-12406563 TGACCAAGGAAACTAACAAGGGG - Intergenic
1185868324 X:3642167-3642189 CGGGCTTGGAAGCTAAGAATTGG + Intronic
1186398295 X:9232768-9232790 GGACCTTGGAATCTCAGAATTGG - Intergenic
1186499679 X:10041259-10041281 TGACCTTGGAAACTAGAAATGGG + Intronic
1187534292 X:20123936-20123958 TGTCTTAGGAATCTAACAATGGG - Intergenic
1188035167 X:25309307-25309329 TGACCTAGCAATCTGAGTATTGG - Intergenic
1188253462 X:27928891-27928913 TGACCTAGAAGGATAAGAAATGG + Intergenic
1188581506 X:31719404-31719426 AGACCTAGGAAGCTAATAGTTGG - Intronic
1189273719 X:39769792-39769814 AGACTTAGGAAGCTAAGAGTGGG + Intergenic
1193354799 X:80506196-80506218 GGACATAGGAAACTAAGAAGTGG + Intergenic
1193659842 X:84243985-84244007 TGGCCTAGAAAGTTTAGAATGGG + Intergenic
1193904527 X:87226153-87226175 TGACATAGGAAGAGAAGACTAGG + Intergenic
1194485166 X:94477648-94477670 TGACAGAGGAAGAGAAGAATAGG + Intergenic
1195318078 X:103698056-103698078 TGACAAAGGAATCTAACAATTGG - Intergenic
1196360929 X:114857089-114857111 TGTCATAGGTAGCAAAGAATCGG - Intronic
1198883981 X:141313219-141313241 TGATCTAGGCAGATAAAAATTGG - Intergenic
1200155248 X:153971615-153971637 TGACCTAGGAGGAAGAGAATAGG - Exonic
1202016503 Y:20412293-20412315 TGACCAAGATAGCTAAGAAGCGG + Intergenic