ID: 1046860800

View in Genome Browser
Species Human (GRCh38)
Location 8:119089256-119089278
Sequence CTAGGTCATGCCTACAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046860798_1046860800 -8 Left 1046860798 8:119089241-119089263 CCTATTCTTAGCTTCCTAGGTCA 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1046860800 8:119089256-119089278 CTAGGTCATGCCTACAATTTTGG No data
1046860795_1046860800 5 Left 1046860795 8:119089228-119089250 CCATTCCTAGTCTCCTATTCTTA 0: 1
1: 0
2: 1
3: 37
4: 365
Right 1046860800 8:119089256-119089278 CTAGGTCATGCCTACAATTTTGG No data
1046860796_1046860800 0 Left 1046860796 8:119089233-119089255 CCTAGTCTCCTATTCTTAGCTTC 0: 1
1: 0
2: 1
3: 24
4: 218
Right 1046860800 8:119089256-119089278 CTAGGTCATGCCTACAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046860800 Original CRISPR CTAGGTCATGCCTACAATTT TGG Intronic
No off target data available for this crispr