ID: 1046872095

View in Genome Browser
Species Human (GRCh38)
Location 8:119215076-119215098
Sequence ATAGGTCATGTGGGCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046872090_1046872095 12 Left 1046872090 8:119215041-119215063 CCTGGTCAAAAGTTCCAGTGGCA 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1046872095 8:119215076-119215098 ATAGGTCATGTGGGCAAATTTGG No data
1046872091_1046872095 -2 Left 1046872091 8:119215055-119215077 CCAGTGGCAGTTACAATAGAAAT 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1046872095 8:119215076-119215098 ATAGGTCATGTGGGCAAATTTGG No data
1046872089_1046872095 13 Left 1046872089 8:119215040-119215062 CCCTGGTCAAAAGTTCCAGTGGC 0: 1
1: 0
2: 1
3: 20
4: 710
Right 1046872095 8:119215076-119215098 ATAGGTCATGTGGGCAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046872095 Original CRISPR ATAGGTCATGTGGGCAAATT TGG Intronic
No off target data available for this crispr