ID: 1046877035

View in Genome Browser
Species Human (GRCh38)
Location 8:119266584-119266606
Sequence GTGTAGGAGCAGAATGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046877031_1046877035 15 Left 1046877031 8:119266546-119266568 CCTAAGGATATTTTAATGGGATT No data
Right 1046877035 8:119266584-119266606 GTGTAGGAGCAGAATGAAGGAGG No data
1046877030_1046877035 16 Left 1046877030 8:119266545-119266567 CCCTAAGGATATTTTAATGGGAT No data
Right 1046877035 8:119266584-119266606 GTGTAGGAGCAGAATGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046877035 Original CRISPR GTGTAGGAGCAGAATGAAGG AGG Intergenic
No off target data available for this crispr