ID: 1046877096

View in Genome Browser
Species Human (GRCh38)
Location 8:119267391-119267413
Sequence AATTATACACAGAGTGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046877095_1046877096 25 Left 1046877095 8:119267343-119267365 CCAGCAATCTTATGAAAGAAAAT No data
Right 1046877096 8:119267391-119267413 AATTATACACAGAGTGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046877096 Original CRISPR AATTATACACAGAGTGCTAT AGG Intergenic
No off target data available for this crispr