ID: 1046879373

View in Genome Browser
Species Human (GRCh38)
Location 8:119291245-119291267
Sequence TAGCCATAGCTTCTCCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046879369_1046879373 19 Left 1046879369 8:119291203-119291225 CCGCCCACTTATTTGCTACTTTT No data
Right 1046879373 8:119291245-119291267 TAGCCATAGCTTCTCCAAAGAGG No data
1046879372_1046879373 -6 Left 1046879372 8:119291228-119291250 CCTGCATTTTTCTACAGTAGCCA No data
Right 1046879373 8:119291245-119291267 TAGCCATAGCTTCTCCAAAGAGG No data
1046879368_1046879373 20 Left 1046879368 8:119291202-119291224 CCCGCCCACTTATTTGCTACTTT No data
Right 1046879373 8:119291245-119291267 TAGCCATAGCTTCTCCAAAGAGG No data
1046879366_1046879373 22 Left 1046879366 8:119291200-119291222 CCCCCGCCCACTTATTTGCTACT No data
Right 1046879373 8:119291245-119291267 TAGCCATAGCTTCTCCAAAGAGG No data
1046879365_1046879373 25 Left 1046879365 8:119291197-119291219 CCTCCCCCGCCCACTTATTTGCT No data
Right 1046879373 8:119291245-119291267 TAGCCATAGCTTCTCCAAAGAGG No data
1046879367_1046879373 21 Left 1046879367 8:119291201-119291223 CCCCGCCCACTTATTTGCTACTT No data
Right 1046879373 8:119291245-119291267 TAGCCATAGCTTCTCCAAAGAGG No data
1046879371_1046879373 15 Left 1046879371 8:119291207-119291229 CCACTTATTTGCTACTTTTAGCC No data
Right 1046879373 8:119291245-119291267 TAGCCATAGCTTCTCCAAAGAGG No data
1046879370_1046879373 16 Left 1046879370 8:119291206-119291228 CCCACTTATTTGCTACTTTTAGC No data
Right 1046879373 8:119291245-119291267 TAGCCATAGCTTCTCCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046879373 Original CRISPR TAGCCATAGCTTCTCCAAAG AGG Intergenic
No off target data available for this crispr