ID: 1046887875

View in Genome Browser
Species Human (GRCh38)
Location 8:119388268-119388290
Sequence CAAGCTGGACACTTGTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046887869_1046887875 7 Left 1046887869 8:119388238-119388260 CCCACTGCAAAGAGGTAAAGCAG No data
Right 1046887875 8:119388268-119388290 CAAGCTGGACACTTGTCACTGGG No data
1046887870_1046887875 6 Left 1046887870 8:119388239-119388261 CCACTGCAAAGAGGTAAAGCAGT No data
Right 1046887875 8:119388268-119388290 CAAGCTGGACACTTGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046887875 Original CRISPR CAAGCTGGACACTTGTCACT GGG Intergenic
No off target data available for this crispr