ID: 1046890430

View in Genome Browser
Species Human (GRCh38)
Location 8:119416173-119416195
Sequence CCACGCGCTCGAGCGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046890421_1046890430 25 Left 1046890421 8:119416125-119416147 CCTGGGAGAAGGCGAAGCAACTT 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1046890430 8:119416173-119416195 CCACGCGCTCGAGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 47
1046890426_1046890430 2 Left 1046890426 8:119416148-119416170 CCAGGAGGAAACGGGCGTTTCCT 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1046890430 8:119416173-119416195 CCACGCGCTCGAGCGAGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046890430 Original CRISPR CCACGCGCTCGAGCGAGCCC TGG Intergenic