ID: 1046890430 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:119416173-119416195 |
| Sequence | CCACGCGCTCGAGCGAGCCC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 51 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 47} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1046890421_1046890430 | 25 | Left | 1046890421 | 8:119416125-119416147 | CCTGGGAGAAGGCGAAGCAACTT | 0: 1 1: 0 2: 0 3: 12 4: 129 |
||
| Right | 1046890430 | 8:119416173-119416195 | CCACGCGCTCGAGCGAGCCCTGG | 0: 1 1: 0 2: 0 3: 3 4: 47 |
||||
| 1046890426_1046890430 | 2 | Left | 1046890426 | 8:119416148-119416170 | CCAGGAGGAAACGGGCGTTTCCT | 0: 1 1: 0 2: 1 3: 5 4: 88 |
||
| Right | 1046890430 | 8:119416173-119416195 | CCACGCGCTCGAGCGAGCCCTGG | 0: 1 1: 0 2: 0 3: 3 4: 47 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1046890430 | Original CRISPR | CCACGCGCTCGAGCGAGCCC TGG | Intergenic | ||