ID: 1046891792

View in Genome Browser
Species Human (GRCh38)
Location 8:119430235-119430257
Sequence GTGTGCTTCTGGAATTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046891792_1046891796 -10 Left 1046891792 8:119430235-119430257 CCTGGACAATTCCAGAAGCACAC No data
Right 1046891796 8:119430248-119430270 AGAAGCACACAGAAAGTTAGGGG No data
1046891792_1046891800 27 Left 1046891792 8:119430235-119430257 CCTGGACAATTCCAGAAGCACAC No data
Right 1046891800 8:119430285-119430307 CCTGTAAGACCTCATTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046891792 Original CRISPR GTGTGCTTCTGGAATTGTCC AGG (reversed) Intergenic
No off target data available for this crispr