ID: 1046895929

View in Genome Browser
Species Human (GRCh38)
Location 8:119473374-119473396
Sequence GGTATTTTGAAACCAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046895929_1046895936 17 Left 1046895929 8:119473374-119473396 CCAGATTTTGGTTTCAAAATACC No data
Right 1046895936 8:119473414-119473436 ACCAGGATTCCTTGGATTAATGG No data
1046895929_1046895939 27 Left 1046895929 8:119473374-119473396 CCAGATTTTGGTTTCAAAATACC No data
Right 1046895939 8:119473424-119473446 CTTGGATTAATGGTCAATTCTGG No data
1046895929_1046895940 28 Left 1046895929 8:119473374-119473396 CCAGATTTTGGTTTCAAAATACC No data
Right 1046895940 8:119473425-119473447 TTGGATTAATGGTCAATTCTGGG No data
1046895929_1046895935 9 Left 1046895929 8:119473374-119473396 CCAGATTTTGGTTTCAAAATACC No data
Right 1046895935 8:119473406-119473428 TATAAGAAACCAGGATTCCTTGG No data
1046895929_1046895931 0 Left 1046895929 8:119473374-119473396 CCAGATTTTGGTTTCAAAATACC No data
Right 1046895931 8:119473397-119473419 ATCCTCCCATATAAGAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046895929 Original CRISPR GGTATTTTGAAACCAAAATC TGG (reversed) Intergenic
No off target data available for this crispr