ID: 1046900324

View in Genome Browser
Species Human (GRCh38)
Location 8:119516707-119516729
Sequence TTGGTAAGAAACAATATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046900321_1046900324 11 Left 1046900321 8:119516673-119516695 CCATTCTCTAACATCTTTACACT No data
Right 1046900324 8:119516707-119516729 TTGGTAAGAAACAATATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046900324 Original CRISPR TTGGTAAGAAACAATATTGT TGG Intergenic
No off target data available for this crispr