ID: 1046901843

View in Genome Browser
Species Human (GRCh38)
Location 8:119532041-119532063
Sequence TAGGATGATTATAATTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046901843_1046901847 25 Left 1046901843 8:119532041-119532063 CCTACCTAATTATAATCATCCTA No data
Right 1046901847 8:119532089-119532111 CAAACAGTTCTATGTTACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046901843 Original CRISPR TAGGATGATTATAATTAGGT AGG (reversed) Intergenic
No off target data available for this crispr