ID: 1046901847

View in Genome Browser
Species Human (GRCh38)
Location 8:119532089-119532111
Sequence CAAACAGTTCTATGTTACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046901844_1046901847 21 Left 1046901844 8:119532045-119532067 CCTAATTATAATCATCCTAAAGC No data
Right 1046901847 8:119532089-119532111 CAAACAGTTCTATGTTACCTAGG No data
1046901843_1046901847 25 Left 1046901843 8:119532041-119532063 CCTACCTAATTATAATCATCCTA No data
Right 1046901847 8:119532089-119532111 CAAACAGTTCTATGTTACCTAGG No data
1046901846_1046901847 6 Left 1046901846 8:119532060-119532082 CCTAAAGCTGTGGTAAGATTACA No data
Right 1046901847 8:119532089-119532111 CAAACAGTTCTATGTTACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046901847 Original CRISPR CAAACAGTTCTATGTTACCT AGG Intergenic
No off target data available for this crispr