ID: 1046905624

View in Genome Browser
Species Human (GRCh38)
Location 8:119569364-119569386
Sequence TCTGACTCCCGTGCAGGCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046905624_1046905627 -3 Left 1046905624 8:119569364-119569386 CCTCAGCCTGCACGGGAGTCAGA 0: 1
1: 0
2: 1
3: 17
4: 157
Right 1046905627 8:119569384-119569406 AGAGGCACTCAGCAATGCCGTGG 0: 1
1: 0
2: 2
3: 13
4: 136
1046905624_1046905628 12 Left 1046905624 8:119569364-119569386 CCTCAGCCTGCACGGGAGTCAGA 0: 1
1: 0
2: 1
3: 17
4: 157
Right 1046905628 8:119569399-119569421 TGCCGTGGCTCTGTTACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046905624 Original CRISPR TCTGACTCCCGTGCAGGCTG AGG (reversed) Exonic