ID: 1046905626

View in Genome Browser
Species Human (GRCh38)
Location 8:119569370-119569392
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046905626_1046905628 6 Left 1046905626 8:119569370-119569392 CCTGCACGGGAGTCAGAGGCACT 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1046905628 8:119569399-119569421 TGCCGTGGCTCTGTTACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1046905626_1046905630 27 Left 1046905626 8:119569370-119569392 CCTGCACGGGAGTCAGAGGCACT 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1046905630 8:119569420-119569442 GGCTGAAATCAAAACCCCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 123
1046905626_1046905627 -9 Left 1046905626 8:119569370-119569392 CCTGCACGGGAGTCAGAGGCACT 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1046905627 8:119569384-119569406 AGAGGCACTCAGCAATGCCGTGG 0: 1
1: 0
2: 2
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046905626 Original CRISPR AGTGCCTCTGACTCCCGTGC AGG (reversed) Exonic