ID: 1046905627 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:119569384-119569406 |
| Sequence | AGAGGCACTCAGCAATGCCG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 152 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 13, 4: 136} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1046905626_1046905627 | -9 | Left | 1046905626 | 8:119569370-119569392 | CCTGCACGGGAGTCAGAGGCACT | 0: 1 1: 0 2: 0 3: 10 4: 131 |
||
| Right | 1046905627 | 8:119569384-119569406 | AGAGGCACTCAGCAATGCCGTGG | 0: 1 1: 0 2: 2 3: 13 4: 136 |
||||
| 1046905624_1046905627 | -3 | Left | 1046905624 | 8:119569364-119569386 | CCTCAGCCTGCACGGGAGTCAGA | 0: 1 1: 0 2: 1 3: 17 4: 157 |
||
| Right | 1046905627 | 8:119569384-119569406 | AGAGGCACTCAGCAATGCCGTGG | 0: 1 1: 0 2: 2 3: 13 4: 136 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1046905627 | Original CRISPR | AGAGGCACTCAGCAATGCCG TGG | Intronic | ||