ID: 1046905628

View in Genome Browser
Species Human (GRCh38)
Location 8:119569399-119569421
Sequence TGCCGTGGCTCTGTTACGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046905626_1046905628 6 Left 1046905626 8:119569370-119569392 CCTGCACGGGAGTCAGAGGCACT 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1046905628 8:119569399-119569421 TGCCGTGGCTCTGTTACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 38
1046905624_1046905628 12 Left 1046905624 8:119569364-119569386 CCTCAGCCTGCACGGGAGTCAGA 0: 1
1: 0
2: 1
3: 17
4: 157
Right 1046905628 8:119569399-119569421 TGCCGTGGCTCTGTTACGAACGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046905628 Original CRISPR TGCCGTGGCTCTGTTACGAA CGG Intronic