ID: 1046905629

View in Genome Browser
Species Human (GRCh38)
Location 8:119569401-119569423
Sequence AGCCGTTCGTAACAGAGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046905629_1046905630 -4 Left 1046905629 8:119569401-119569423 CCGTGGCTCTGTTACGAACGGCT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1046905630 8:119569420-119569442 GGCTGAAATCAAAACCCCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046905629 Original CRISPR AGCCGTTCGTAACAGAGCCA CGG (reversed) Intronic