ID: 1046906972

View in Genome Browser
Species Human (GRCh38)
Location 8:119583856-119583878
Sequence CAGTATTCATAAATAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046906972 Original CRISPR CAGTATTCATAAATAGAGGA AGG (reversed) Intronic
905618987 1:39424525-39424547 CATTATTTATAAATATAAGAGGG - Intronic
909812656 1:79950670-79950692 CAGTATTCATAAATATGAGAGGG - Intergenic
910286949 1:85566202-85566224 CAGTATTAAAAAGTAGAGAATGG + Intronic
911080782 1:93928067-93928089 CAGTTTTCATTATTATAGGAGGG - Intergenic
913324900 1:117619069-117619091 AAGTATTCACCAATAGAAGATGG - Intronic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
918794562 1:188875394-188875416 AAGTATTCTTAAATAATGGATGG + Intergenic
918828658 1:189362059-189362081 CAGTTTTTATTAATAGAGGCTGG + Intergenic
919371206 1:196728478-196728500 CAGTCTGCATAAATGGAAGATGG + Exonic
920024162 1:202980228-202980250 CAGTGTTCTTCATTAGAGGAAGG - Intergenic
923299411 1:232627934-232627956 GTGTATTCATAAATAGCTGAAGG - Intergenic
924315753 1:242794556-242794578 CAATATTCTTAAAAAGAGCAGGG - Intergenic
1063266381 10:4455834-4455856 CAGTACACAGAAATAGAAGATGG + Intergenic
1063956500 10:11272479-11272501 CAGTTTTCAGAAATGGTGGATGG - Intronic
1065464433 10:26004026-26004048 AATTATTCATAAAGAAAGGAAGG - Intronic
1066169818 10:32829314-32829336 CAGAATGCATAAGTAGAAGAAGG + Intronic
1066995398 10:42558456-42558478 CAGTATGCAAAAATAGAGAAAGG - Intergenic
1067184777 10:44017287-44017309 GAGAATTCAGAAATAGAGCAGGG + Intergenic
1068143285 10:53032158-53032180 TATTATTCTTAAAAAGAGGAAGG + Intergenic
1068461858 10:57339771-57339793 CAGGATTAATAATTACAGGAAGG - Intergenic
1069361698 10:67650415-67650437 CAGTTTTCAGAATTAAAGGAAGG + Intronic
1070314320 10:75295671-75295693 GAGTATTCATTAATATAAGAAGG - Intergenic
1070832519 10:79427872-79427894 CTGTCTCCATAAAAAGAGGAAGG + Intronic
1073821176 10:107265988-107266010 ATATATTCAAAAATAGAGGAAGG - Intergenic
1074242788 10:111655431-111655453 CGATATGCATAAATAGAGGAAGG + Intergenic
1080822480 11:35820671-35820693 CAGTATTCATTAATAGGGGACGG + Intergenic
1080845383 11:36022208-36022230 CATGATTAATAATTAGAGGAAGG - Intronic
1082738169 11:56880330-56880352 TGGTATTTCTAAATAGAGGATGG + Intergenic
1084946594 11:72642135-72642157 TAGAATTCAGAACTAGAGGAGGG + Intronic
1087076645 11:94131996-94132018 CAGTAATTATCAACAGAGGAAGG - Intronic
1087147212 11:94824092-94824114 CAGTATTCCTGCACAGAGGATGG + Intronic
1089630976 11:119783966-119783988 CAGTTTTCACAAATAGAATATGG + Intergenic
1091923755 12:4327095-4327117 CAGTATTTATAGACAGAGAAAGG + Intronic
1095859054 12:46894298-46894320 CAATATTCATAAACAGAAAAAGG + Intergenic
1099551143 12:84044462-84044484 GAGAATTCACAAAGAGAGGATGG - Intergenic
1099714337 12:86271748-86271770 TAGTTTTCATCAATAGATGATGG + Intronic
1102257034 12:111421788-111421810 AAATATTCATCAACAGAGGATGG - Intronic
1102425106 12:112837918-112837940 AAGTGTTTATTAATAGAGGAAGG - Intronic
1103598614 12:122039869-122039891 CTGTATTCAAAAATAGAGACAGG + Intronic
1104184545 12:126417277-126417299 CAGTATTCTTCAATAGTGGAAGG + Intergenic
1107315660 13:39128791-39128813 CAGTTTGCAGAAATAGCGGAGGG + Intergenic
1107773636 13:43814593-43814615 CAGGATCCATACAGAGAGGAAGG - Intergenic
1109410313 13:61956650-61956672 CAAAATTCATGAATAAAGGAAGG + Intergenic
1109940342 13:69355059-69355081 TAATATTCATCATTAGAGGAAGG - Intergenic
1110620832 13:77593725-77593747 AAGTATTCCTGAATAGTGGATGG + Intronic
1110657929 13:78022664-78022686 CAGTACTCATATATAGAATAAGG - Intergenic
1110734665 13:78922181-78922203 CATTATTAAAAAATAGAGAAAGG - Intergenic
1111073786 13:83205565-83205587 AAGTAGTCATAAATAAAGGAGGG + Intergenic
1114567919 14:23646053-23646075 CAGTATGCATACACAGAGGGCGG - Intergenic
1115653888 14:35424282-35424304 CAGTACTTATAAACAGAGGAGGG + Intergenic
1115660297 14:35487685-35487707 CAGTTTTCATCAACAGATGAAGG - Intergenic
1116214727 14:41998975-41998997 CAGTCTTCATAATTGAAGGATGG - Intergenic
1119901603 14:78265080-78265102 TAGTATTCAGAAAAAGAGTACGG - Intronic
1120508775 14:85386642-85386664 CAATATTGATAAAAAGAGCAAGG - Intergenic
1121872176 14:97418575-97418597 CAGTTTGCCTAAATGGAGGAGGG - Intergenic
1123150296 14:106175023-106175045 GAGTGTTCATAAATGGAGCAGGG - Intergenic
1126293208 15:47105993-47106015 CTGGAGACATAAATAGAGGAAGG - Intergenic
1127935147 15:63629896-63629918 CCTCCTTCATAAATAGAGGAGGG + Intronic
1129984335 15:79903992-79904014 CAGCATTCATAAGGAAAGGATGG - Intronic
1129991372 15:79966632-79966654 CAGCATTCATAAGGAAAGGATGG - Intronic
1132173579 15:99689024-99689046 CAGTATTCATGAAAACAGGATGG + Intronic
1133845572 16:9450586-9450608 AAACATTCATAAATACAGGAGGG - Intergenic
1134534775 16:15017244-15017266 CAGTTTTTATGAATGGAGGAGGG + Intronic
1137602276 16:49764316-49764338 CAGTGTCCATCAACAGAGGAAGG + Intronic
1139861265 16:70023532-70023554 CAGTTTTTATGAATGGAGGAGGG - Intergenic
1141155766 16:81595782-81595804 CAGTATCCATCAACAGATGATGG - Intronic
1143522741 17:7454674-7454696 CAGTATTGATGAAGAGAGTATGG - Intronic
1145391222 17:22457165-22457187 CATGATTCATAAATAGAGATGGG + Intergenic
1153151664 18:2102149-2102171 CAGTATTAATAAAGAGAGAGTGG - Intergenic
1156613828 18:38759866-38759888 TAATATTCATATATAGAGGAAGG + Intergenic
1157096554 18:44690541-44690563 CACCATTTATAAATTGAGGAAGG - Intronic
1159297612 18:66516443-66516465 CAGTGTTCATAAATTGAGAATGG + Intronic
1159711937 18:71771695-71771717 CACTATGCATATATAGAAGATGG - Intronic
928409017 2:31039705-31039727 CATTATTCATAAACATAGGAGGG + Intronic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
934896225 2:98122417-98122439 CAGTATTGATAAACACAGGCCGG - Intronic
935757023 2:106284163-106284185 CCGTATCCAGAAATAGATGATGG + Intergenic
936803639 2:116297706-116297728 CAGTCTTCAAATATAAAGGAGGG + Intergenic
937108470 2:119342114-119342136 CAGAATTGATAAGTAAAGGATGG + Intronic
941354293 2:164469864-164469886 GGGTTTTCATACATAGAGGAAGG + Intergenic
941754315 2:169168257-169168279 TAGTATGCATAAATAAAGGCAGG - Intronic
942121353 2:172781194-172781216 CAATATTCATAAATTTAGAAAGG + Intronic
943567960 2:189539211-189539233 CAGTATGTATATAGAGAGGAGGG - Intergenic
946525369 2:220513226-220513248 GAATATTCAGAAATAGAGTAAGG + Intergenic
947025379 2:225732215-225732237 CTGTATTCAAAGATAGAGGTAGG + Intergenic
947632678 2:231664083-231664105 CCGTAACCATAAACAGAGGACGG - Intergenic
1169861204 20:10154482-10154504 CAATATACAGAAAGAGAGGAAGG + Intergenic
1171804936 20:29668581-29668603 CTGGAGACATAAATAGAGGAAGG - Intergenic
1171839123 20:30187847-30187869 CTGGAGACATAAATAGAGGAAGG + Intergenic
1174817922 20:53702629-53702651 CAGTGTTTATAAATAGTGGGGGG + Intergenic
1177522814 21:22251606-22251628 CAGTCTACTTAAAAAGAGGAAGG - Intergenic
1178540151 21:33442550-33442572 CAGTTATCAAAAAAAGAGGAGGG + Intronic
1178613191 21:34105191-34105213 CAGAGTTCAGAAATAGAGCAGGG + Exonic
1179248201 21:39651194-39651216 CTATATTCATAAAGAAAGGAAGG - Intronic
1179400904 21:41082289-41082311 CAGTCCTCATTAATAGAGCATGG + Intergenic
1181508021 22:23374808-23374830 CAGTGGTCATGGATAGAGGAGGG - Intergenic
949780496 3:7681458-7681480 AACTATTCATAAATAGAGACAGG - Intronic
951032742 3:17900872-17900894 CACTATTATTAAATACAGGAAGG - Intronic
951923785 3:27885196-27885218 CAGTATACAGAAAGAGAGTATGG + Intergenic
952038143 3:29229096-29229118 AAATATTCTTAAATAGAGAAAGG - Intergenic
956031373 3:65041395-65041417 CAGTATTTATAGACAGAGTAAGG - Intergenic
956073909 3:65484497-65484519 CACTATACATAAAGAGAGTAAGG - Intronic
958493279 3:94806246-94806268 CAGGATACAAAAACAGAGGAAGG + Intergenic
961425883 3:126847540-126847562 CATTATTAATAAATAGAATATGG - Intronic
962935168 3:140074048-140074070 CAGTAGCCATAAGTGGAGGAGGG - Intronic
963756997 3:149245100-149245122 TAGTAATCATAAATAAAGAATGG - Intergenic
966040076 3:175472976-175472998 AAGTATCCAGAAATAGAGGAGGG + Intronic
969177573 4:5410526-5410548 AAGTGTTCATAAAAAGAGCAAGG + Intronic
970042954 4:11817346-11817368 CACTTTTCATAAATAGAATATGG - Intergenic
970936546 4:21577769-21577791 CAGAATTTCCAAATAGAGGAAGG - Intronic
974256551 4:59463096-59463118 CAAAATTGAAAAATAGAGGAAGG + Intergenic
975158233 4:71095608-71095630 AAGTATTAATAATTATAGGAGGG - Intergenic
975957747 4:79862087-79862109 CAGTATTCTTGAATTGAGCAGGG + Intergenic
977094363 4:92720765-92720787 CACTATTCAAAAATTGATGATGG + Intronic
977544180 4:98356416-98356438 CAGGAATTATAAATACAGGATGG - Intronic
978092690 4:104737265-104737287 CAGTGTTAATAAATTGAGGGTGG + Intergenic
980246473 4:130251121-130251143 CAGCATTCAAAATTACAGGAAGG + Intergenic
980645526 4:135637463-135637485 CAGTATTCCCACATATAGGATGG + Intergenic
982147187 4:152407727-152407749 CAGAATAAATAAATAGAGGGTGG - Intronic
983138398 4:164115957-164115979 AAGTATTCATAATTAGAGATAGG - Intronic
983307743 4:166014690-166014712 CAGTAATCATAAAATGAGGCAGG + Intronic
983415083 4:167442254-167442276 AAGTTTTCATAAATAAAGGGTGG - Intergenic
984046525 4:174806510-174806532 AAATATTCAGAAAAAGAGGATGG + Intronic
986503712 5:8428371-8428393 CAGTATTGATGATTAGAGGTAGG + Intergenic
986570934 5:9165393-9165415 CAGAATTAATAAAAAGAGAATGG - Intronic
987474159 5:18370149-18370171 AAGTTTTTAAAAATAGAGGATGG + Intergenic
988936900 5:36093010-36093032 TAGAATTCATAAAGTGAGGAGGG - Intergenic
988950286 5:36250790-36250812 CAGGATTCACAAATAAAGTAAGG - Intronic
989090150 5:37721987-37722009 GAATATTCATTAATAGAGGCTGG - Intronic
993043454 5:82841235-82841257 GAGTATTCATATACAGAGTATGG - Intergenic
993364131 5:87015580-87015602 CAGTATTGATAAATATTGTATGG + Intergenic
996865327 5:128115042-128115064 CAGTTTTCCTCAATAGGGGATGG - Intronic
997296036 5:132769044-132769066 CAGTATTCACAACCAAAGGAAGG + Intronic
998440044 5:142151748-142151770 GAGAATTCATAAATGCAGGAAGG - Exonic
999477626 5:151915484-151915506 AAGTGTTCATCAATAGGGGATGG + Intronic
1001637844 5:173225282-173225304 CAGTGTAAATAAATAGATGATGG - Intergenic
1003991382 6:11490062-11490084 CAGTAATCATCAGTGGAGGAGGG + Intergenic
1006013076 6:31058474-31058496 CAGTATTCACCAGTAGAGGGAGG + Intergenic
1006215018 6:32434089-32434111 CAGAATTCATAAAGAAATGATGG + Intergenic
1006245147 6:32727201-32727223 CAGTCTTCAGAAACAGAAGAAGG + Intergenic
1006891093 6:37429526-37429548 CAGTATTTATAGATAGAAAAAGG + Intergenic
1009992924 6:70865655-70865677 CAGTAATCATATATGGAGGTAGG - Intronic
1012188988 6:96257955-96257977 TTGAATTCATAATTAGAGGAGGG - Intergenic
1013825565 6:114206737-114206759 CAGTATTTATAAACATAGAATGG + Intronic
1016448698 6:144158599-144158621 AAGCATTCATAAATGTAGGATGG + Intronic
1016448707 6:144158739-144158761 AAGCATTCATAAATGTAGGATGG + Intronic
1016685462 6:146876975-146876997 CAATATTCATGAGTAGAGGTTGG - Intergenic
1023173066 7:37408509-37408531 AAATATTCATTAATAGATGAAGG + Intronic
1025287636 7:57679285-57679307 CTGGAGACATAAATAGAGGAAGG + Intergenic
1026116630 7:67501478-67501500 TAGTTTTCCTAAATAGAAGAAGG + Intergenic
1026497727 7:70918317-70918339 CAGTATAGATAAGTGGAGGATGG + Intergenic
1027860578 7:83573715-83573737 TACTAATCATAAATAGAGAAAGG + Intronic
1028096096 7:86763029-86763051 CAGTATACATTGATAGAAGATGG + Intronic
1028701420 7:93785218-93785240 CAGTACCCAGAAATAGAAGATGG + Intronic
1030763423 7:113379274-113379296 CAGTATGAATATATATAGGAGGG + Intergenic
1030878108 7:114841453-114841475 CAGTAATAATAAATAGTGTAAGG + Intergenic
1033352267 7:140571108-140571130 CAGTAAACAAAAATATAGGATGG + Intronic
1035182474 7:157099366-157099388 CAGTATTCCTACAGAGAGGATGG + Intergenic
1037065753 8:14574970-14574992 CGGTTTTCATTAAAAGAGGATGG + Intronic
1037226129 8:16592706-16592728 CAATATTCATATATATAGAATGG + Intergenic
1037483750 8:19328495-19328517 CAGTATTCAAGAATTTAGGAAGG - Intronic
1039272515 8:35898441-35898463 TGGTATTCATAAATAGATGCAGG - Intergenic
1039792196 8:40884976-40884998 CAGTATTTATAGATCTAGGATGG - Intronic
1040703733 8:50100013-50100035 AAGTGTTCATCAATAGATGACGG + Intronic
1040939156 8:52815251-52815273 CAGTATTCTTTGATGGAGGAGGG - Intergenic
1041326223 8:56668159-56668181 CTGCATTCATTAATAGAGAATGG - Intergenic
1042140828 8:65677022-65677044 CAGTTTTCATAGATAAAGCATGG + Intronic
1042613137 8:70619576-70619598 CAGCAATCACAGATAGAGGAAGG + Intronic
1044575558 8:93765553-93765575 CTGTCTTCATAAATAAATGAGGG - Exonic
1044912646 8:97077061-97077083 TGGTATTGATAAATAGAGTACGG - Intronic
1046906972 8:119583856-119583878 CAGTATTCATAAATAGAGGAAGG - Intronic
1046950694 8:120016907-120016929 CAGAATTCATACATTGAGGTTGG - Intronic
1047379060 8:124339392-124339414 CAGTATTTATAGATAGAAAAAGG - Intronic
1047413177 8:124640867-124640889 CAGTATAAATAAAGAGGGGATGG - Intronic
1047795418 8:128250113-128250135 CAGTAATCACAAGAAGAGGAAGG + Intergenic
1048160508 8:132016646-132016668 CAGTATACATCAATAATGGATGG - Intergenic
1052015973 9:23467500-23467522 CAAAATTCTTAAATAGAAGATGG - Intergenic
1052221967 9:26035366-26035388 CAGAATTCAGGAGTAGAGGAGGG + Intergenic
1054923751 9:70567300-70567322 CAGTATTCATGAAGACAGGAGGG + Intronic
1055051291 9:71984002-71984024 CAGTTTTCATCATTAAAGGAAGG - Intronic
1055817540 9:80224615-80224637 CAGTATTCACAAAAGCAGGAAGG + Intergenic
1187173786 X:16876543-16876565 CAGTAGTCATTGATGGAGGAAGG - Intergenic
1188563792 X:31501202-31501224 CAGTATTTATAGATAGAAAAAGG - Intronic
1188622355 X:32241496-32241518 CAGTATTCAAAACCAGAGGCTGG - Intronic
1189884203 X:45523670-45523692 TAGTATTTTTTAATAGAGGAAGG + Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1191986507 X:66986811-66986833 CAGTATTTTTAAATAGACAAAGG - Intergenic
1194007439 X:88513453-88513475 AACTATACATAAATAGATGATGG + Intergenic
1194809125 X:98368937-98368959 CAGCATGAATAAAAAGAGGAGGG + Intergenic
1201241504 Y:11961274-11961296 GATTATTGATAAATAGATGATGG - Intergenic
1201730764 Y:17200386-17200408 CAGTTACCATCAATAGAGGATGG - Intergenic