ID: 1046909429

View in Genome Browser
Species Human (GRCh38)
Location 8:119609562-119609584
Sequence CTAGGGTTCAGAATGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046909421_1046909429 -5 Left 1046909421 8:119609544-119609566 CCAGGAACCCCAGCCCAACTAGG 0: 1
1: 0
2: 0
3: 22
4: 173
Right 1046909429 8:119609562-119609584 CTAGGGTTCAGAATGTGTCCTGG No data
1046909420_1046909429 -2 Left 1046909420 8:119609541-119609563 CCTCCAGGAACCCCAGCCCAACT 0: 1
1: 0
2: 0
3: 32
4: 408
Right 1046909429 8:119609562-119609584 CTAGGGTTCAGAATGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046909429 Original CRISPR CTAGGGTTCAGAATGTGTCC TGG Intronic
No off target data available for this crispr