ID: 1046910486

View in Genome Browser
Species Human (GRCh38)
Location 8:119621012-119621034
Sequence AAAGGGAAGCAGGATAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1495
Summary {0: 2, 1: 0, 2: 15, 3: 162, 4: 1316}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046910486 Original CRISPR AAAGGGAAGCAGGATAGGGA AGG (reversed) Intronic
900017402 1:162223-162245 AAAGGGAAGGAGGGAAGGAAAGG + Intergenic
900047661 1:520819-520841 AAAGGGAAGGAGGGAAGGAAAGG + Intergenic
900069875 1:762687-762709 AAAGGGAAGGAGGGAAGGAAAGG + Intergenic
900295797 1:1948897-1948919 AAAGGGAAGGAAGGAAGGGAAGG - Intronic
900394090 1:2446093-2446115 ACAGGGAAGCAGGACGGGGGTGG - Intronic
900638345 1:3676374-3676396 AAAGGGAAAGGGGACAGGGAAGG + Intronic
900699007 1:4032410-4032432 ACACGGAAGCAGGAAAGGGATGG - Intergenic
900932838 1:5747645-5747667 AGAGGGAGGGAGGAGAGGGAGGG + Intergenic
901187585 1:7385064-7385086 ACAGGCAAGCAGGATGGGCAGGG - Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901422796 1:9162327-9162349 AAAGGGAAGAAGAAGAGGGGAGG + Intergenic
901560453 1:10066119-10066141 AAAGGGAAGGAAGGTAGGAAGGG - Intronic
901748957 1:11394108-11394130 AAAGGGAGCCAGGATAGGCTGGG - Intergenic
902083541 1:13838601-13838623 AAAGGGAAGGAAGGAAGGGAAGG - Intergenic
902130525 1:14256473-14256495 AAAGGGAAGGAAGAGAGGGAAGG + Intergenic
902279334 1:15362852-15362874 AAATGGAAGCAGCACTGGGAAGG - Intronic
902364099 1:15959532-15959554 GAAGGGAGGGAGGAGAGGGAGGG + Intronic
902610968 1:17596938-17596960 AAAGAGCAGCAGGGCAGGGAGGG - Intronic
902625329 1:17673128-17673150 AAAGGGAACCGGTACAGGGAAGG + Intronic
903002850 1:20278777-20278799 AAGGGGAAGCAAGAGAGAGATGG + Intergenic
903149877 1:21399125-21399147 AAAGGGAAGGAGCAAAGAGATGG + Intergenic
903214368 1:21835334-21835356 GGAGGGAAGAAGGATATGGATGG - Intronic
903461551 1:23524463-23524485 AAAAGGAAGCTGGATCTGGAGGG - Exonic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904194002 1:28770945-28770967 GAAGGGAAGAAGGGAAGGGAAGG - Intergenic
904459804 1:30669567-30669589 AAAGGCAAGCAGGATTGGCCAGG + Intergenic
904558232 1:31379566-31379588 ACATCAAAGCAGGATAGGGAAGG - Intergenic
904948157 1:34214434-34214456 AAGAGGAAGCAGGATAGGGTGGG + Intronic
905520972 1:38599411-38599433 GAAGGAAAGCAGGATAGGAAGGG - Intergenic
905540449 1:38756239-38756261 GTAGGGAAGTAGGACAGGGATGG - Intergenic
905583778 1:39101834-39101856 AAAGGAAAGAAAGAAAGGGAGGG + Intronic
905680324 1:39865990-39866012 AAAGGGAGGAAAGAAAGGGAAGG + Intronic
905912609 1:41664231-41664253 AACGGGAAGCAGGACAGTGGGGG - Intronic
905942976 1:41878868-41878890 AAAAGGAAGGAGGGGAGGGAGGG - Intronic
905949240 1:41933877-41933899 GAAGTGAAGCAGGGGAGGGATGG - Intronic
905958945 1:42026934-42026956 GAAGGGAAGCAGCATAGAAATGG - Intronic
906073416 1:43034454-43034476 TAAAGGAAGAAGGAAAGGGAAGG - Intergenic
906153695 1:43602027-43602049 AAAGGGAGACAGGATGGTGAAGG - Intronic
906294822 1:44643170-44643192 AAAGGCAAGCAGCATCGGGAAGG - Intronic
906745134 1:48216084-48216106 AATGGGAAGCTGGATGGGGCAGG + Intergenic
907016128 1:51014930-51014952 AAAGGGAAGGAAGGAAGGGAAGG + Intergenic
907165975 1:52411700-52411722 AAAGGGAAGCAGGATGGTGAAGG - Intronic
907696069 1:56730401-56730423 GAGGGGAAGGAGGAGAGGGAGGG + Intronic
907728112 1:57039344-57039366 AAAGGGAAGGAAGGAAGGGAGGG + Intronic
907843816 1:58185235-58185257 AGAGGGAAGCAGGAGAAGGATGG + Intronic
907906942 1:58791139-58791161 AAAGGGAAGCAAGAGAGAAAAGG + Intergenic
908296539 1:62718576-62718598 GAAGGGAGGGAGGAAAGGGAGGG + Intergenic
908582582 1:65531411-65531433 AAAGGAAAGGAGGAAAGGAAAGG - Intronic
909603068 1:77480922-77480944 GAGGAGAAGCAGGATAGGGCAGG + Intronic
909647564 1:77934611-77934633 AGAGGGAAGAAGGTTAGGCAGGG - Intronic
909699104 1:78500595-78500617 AGAAGGAAGCAGGATTGGGTAGG - Intronic
909903360 1:81165947-81165969 AAAGGAAAGCAGTATAGCAAAGG + Intergenic
909938411 1:81581928-81581950 AAGGGGAAACAGGACAGGCATGG + Intronic
910002127 1:82353856-82353878 AAGTGGAAGCAGGAGAGAGAGGG + Intergenic
910028509 1:82687913-82687935 AAGGGGAGGCAGGAGAGGCAGGG - Intergenic
910067883 1:83175119-83175141 AAATTGAAACAGGATAGTGAAGG + Intergenic
910179088 1:84462122-84462144 AAAGGAAAGCAGGAAAGGGTTGG - Intergenic
911027441 1:93449125-93449147 AAAGGCAAGGAGGAAAGGAAAGG - Intronic
911141265 1:94504961-94504983 AAAGGGAAGAGGAAAAGGGAAGG + Intronic
911189835 1:94936826-94936848 AAAGGGAAGGAGGATCAGAAAGG + Intergenic
911210993 1:95137724-95137746 AAAGAGAAGGAAGAAAGGGAGGG - Intronic
911236022 1:95413241-95413263 AAAGGGGAGCAGGAGACAGAAGG - Intergenic
911244306 1:95499958-95499980 AAAGGGAAGCAGGTTTAAGAGGG - Intergenic
911881250 1:103240794-103240816 AGAGTGAAGCAGTATAGGAAAGG - Intergenic
912336886 1:108871522-108871544 AGAGTGAAACAGGATAGGGAAGG - Intronic
912408700 1:109465240-109465262 GAAGGGAAGAAGGGAAGGGAAGG - Intergenic
912566643 1:110592336-110592358 AAAAGCAAGGAGGAAAGGGAGGG - Intergenic
912881240 1:113417603-113417625 AATGGGAAAAAGGATAGGGGAGG - Intronic
913090528 1:115473750-115473772 AGAGAGAAGCAGGGTAAGGAAGG + Intergenic
913195683 1:116454409-116454431 AAAGGGAAGGAGGGAAGGAAAGG + Intergenic
913394048 1:118346876-118346898 AAAAGGAGGCAGGATTGGGTGGG - Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
914804953 1:150984869-150984891 AAAGAGAAGCAGGCCAGGTACGG + Intronic
914829529 1:151160589-151160611 AAAGGTAAAAAGGATAGGAAAGG + Exonic
914862301 1:151396945-151396967 AAAGGAAAGAAGGAAAGGAAAGG - Intergenic
914916458 1:151822285-151822307 ACAGGGGAGCAGGAGCGGGAGGG + Intronic
915112625 1:153574478-153574500 AAAGGGGAGAGGGAGAGGGAGGG - Intergenic
915297231 1:154929813-154929835 AAAGGGATCCAGGATAGGAGGGG + Intronic
915345800 1:155196260-155196282 AAAGGGAGGCAGGAAGGAGAGGG + Intronic
915507759 1:156368278-156368300 ACAGGGAAGCAGGCTGGGCAGGG - Intergenic
915525525 1:156473788-156473810 AGAGGGAAGAAGGTTAGAGAGGG - Intronic
915527562 1:156485335-156485357 TGAGGGAAGGAGGAGAGGGAAGG + Intronic
915543643 1:156583706-156583728 AGAAGGAAACAGGAAAGGGAGGG - Intronic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
916055281 1:161064940-161064962 GAAGGGAAGAAGGGAAGGGAAGG + Intronic
916188031 1:162152132-162152154 TCATGGTAGCAGGATAGGGATGG + Intronic
916225103 1:162481979-162482001 AAAGGAAATCAGTATATGGAAGG + Intergenic
916229842 1:162530866-162530888 AAAGGGAAGCTGGATCTGGAAGG - Intergenic
916304790 1:163318219-163318241 AAAGGGAAACAAGACTGGGAAGG + Intronic
917178737 1:172268544-172268566 AAAGGGAGCCTGGAGAGGGATGG + Intronic
917503495 1:175606962-175606984 GAAGTGAAGCAGGACAAGGAAGG - Intronic
917553948 1:176064911-176064933 AAAGGGAAGGAGGCCAGGCATGG - Intronic
917665918 1:177225510-177225532 AAACTGAAGCACGATGGGGAAGG + Intronic
917787760 1:178477171-178477193 AAAGGGAAGGAGAATGGAGAAGG - Intronic
918069470 1:181124455-181124477 AAGGGGAAGCAGGGAAGGGGAGG - Intergenic
918085864 1:181244754-181244776 AAGGGGAAAGAGGAGAGGGAGGG + Intergenic
918192739 1:182191851-182191873 TAAGGAAAGCAGGCCAGGGAAGG + Intergenic
918543279 1:185654484-185654506 GAAGGAAAGAAGGAAAGGGAAGG - Intergenic
919055562 1:192565715-192565737 AAAGGAAAGAAAGAGAGGGAGGG + Intergenic
919651489 1:200153775-200153797 AAAAGGAAGGAGGAAAGGTATGG + Intronic
919744464 1:200999978-201000000 ACAGGGAAGCTGGATTAGGAAGG + Intronic
919846019 1:201642670-201642692 AAAGGGAAGAAAGAGAGGGAGGG - Intronic
919999879 1:202789581-202789603 AAAGGAAAGGAGGAAAGGGAAGG + Intronic
920004632 1:202823980-202824002 GAAGGAAAGCAGAAGAGGGAAGG + Intronic
920222849 1:204416853-204416875 AAAAGGAAGAAGGAAAGGAAAGG + Intergenic
920398193 1:205661304-205661326 AAAGGGAAGGAGGCAAAGGAGGG + Intronic
920690307 1:208141659-208141681 AAAGAGAAGCAGGGAAGGCAGGG - Intronic
920944139 1:210512334-210512356 AAAGGGAAGCAGGTGAGGGGGGG - Intronic
921435527 1:215115707-215115729 AAAGGAAAGCATGAAAGAGAAGG - Intronic
921964708 1:221076026-221076048 GAAGAGAAGAAGGAGAGGGAAGG - Intergenic
922027717 1:221767175-221767197 AAAGGGGAGGAGGAAAAGGAGGG - Intergenic
922070644 1:222189319-222189341 GAAGGGAAGAAGGGAAGGGAAGG + Intergenic
922217552 1:223532673-223532695 CAATGGAAGCTGGATTGGGAGGG - Intergenic
922265558 1:223980675-223980697 AAAGGGAAGGAGGGAAGGAAAGG + Intergenic
922305687 1:224342190-224342212 AAATGGAAGCAGGCCAGGGGTGG - Intergenic
922310010 1:224379745-224379767 AAAGGGCAGCAAGATAGAGAAGG + Intergenic
922403850 1:225291008-225291030 AAGGGAGAGAAGGATAGGGAGGG - Intronic
922691418 1:227694984-227695006 AAAAGAAAGAGGGATAGGGAGGG - Intergenic
922891528 1:229065650-229065672 AAAAGGAAGTAAGAGAGGGAGGG - Intergenic
922931366 1:229392394-229392416 TAAGGGAAGCAGGAAAGGGAAGG - Intergenic
922967590 1:229704069-229704091 AAAGGAAAGAAGGGAAGGGAAGG - Intergenic
923063036 1:230494658-230494680 AAAGGGAGGAAGGAAAGGAAAGG + Intergenic
923339831 1:232997827-232997849 AGTGAGAAGCAGGAGAGGGAAGG + Intronic
923461027 1:234209604-234209626 GAGGGGTAGCAGGATAGGGCAGG + Intronic
923538154 1:234868971-234868993 AAAGGAAAGGAGGAAAGGAAAGG + Intergenic
923651280 1:235876317-235876339 TGTGGGAAGCAGGAGAGGGAGGG - Intronic
923678258 1:236098526-236098548 GAAGGGAAGGAGGGAAGGGAAGG + Intergenic
923776101 1:236979887-236979909 AGAGGAAAGCAGGAGATGGAAGG + Intergenic
923793647 1:237132973-237132995 AAAGGGAAGGAAGAGAGGGTAGG + Intronic
923983398 1:239352381-239352403 ACAGAGAACCAGGAGAGGGAAGG - Intergenic
924347418 1:243085674-243085696 AAAGGGAAGGAGGGAAGGAAAGG + Intergenic
924453882 1:244202331-244202353 ATAGGGAAGAAGGGAAGGGAAGG + Intergenic
924510152 1:244723307-244723329 TAAGGGAGGCTGGAGAGGGAGGG + Intergenic
924554783 1:245109032-245109054 AAAGGGAAGCAGGCCAGTAAAGG + Intronic
1063348733 10:5335715-5335737 AAAGGGAAAAAGGAAAGGAAAGG + Intergenic
1063576308 10:7265170-7265192 AGAGGGAGGCAGGGGAGGGAGGG - Intronic
1063759704 10:9058875-9058897 CAAGGGAAGAAGGAAAGAGAAGG - Intergenic
1063963528 10:11326900-11326922 AAAGGAAAGTAGCAAAGGGAGGG + Intronic
1064121569 10:12623510-12623532 AAAAGGAAGGAAGAGAGGGAGGG - Intronic
1064389298 10:14927601-14927623 GAAGGGATGGAGGAGAGGGAGGG + Intronic
1064403519 10:15040581-15040603 AAAGGGAAGTGGGGAAGGGAAGG - Intronic
1064818696 10:19298441-19298463 AAAGACAAGAAGGATAGGAAAGG + Intronic
1064911378 10:20405418-20405440 AAAGGAAAGAAGGGTAGGGGAGG - Intergenic
1065203023 10:23331561-23331583 GAAGGGAACCGGGATGGGGAAGG + Intronic
1065203065 10:23331665-23331687 AAAGGGAAAAGGGAAAGGGAAGG + Intronic
1065421977 10:25555047-25555069 AAAGGAAAGAAGGGGAGGGAGGG + Intronic
1065497273 10:26342059-26342081 GAAGGGAAGGAGTAGAGGGAGGG + Intergenic
1065853870 10:29814139-29814161 AGAGGGAAGGAGGAAAGAGAAGG - Intergenic
1065866571 10:29919951-29919973 AAAGGGGAGGAGGAGAGAGAAGG - Intergenic
1066021069 10:31302734-31302756 AAAGGGAAGGAAGGAAGGGAGGG - Intergenic
1067179123 10:43971744-43971766 GACGGGAAGCAAGATAGGGGAGG + Intergenic
1068839288 10:61592129-61592151 AGAAGGAAGCAGGAAAGGGCAGG - Intergenic
1068875340 10:61990038-61990060 AAAGGGAACCTACATAGGGATGG - Intronic
1068986997 10:63116851-63116873 AAAGGGAAACAGGCCAGGCATGG + Intergenic
1069027657 10:63561399-63561421 AAGAGGAAGAAAGATAGGGAGGG + Intronic
1069247181 10:66220685-66220707 GATGGGAAGCTGGAAAGGGAGGG + Intronic
1069258262 10:66361414-66361436 AAAAGAAAGAAGGAAAGGGAAGG - Intronic
1069701453 10:70429583-70429605 AAAGGCAATTAGGATAGGTAAGG + Intergenic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070373468 10:75807235-75807257 AGAGGGATGCAGCACAGGGAGGG + Intronic
1070428134 10:76309144-76309166 AAAGGGAAAGAGGATATGGGAGG + Intronic
1070603399 10:77881435-77881457 AAAGGGAAGCATGAGAAAGAAGG + Intronic
1070608123 10:77913913-77913935 AAAAGGAAGAAAGACAGGGAGGG + Intronic
1070747924 10:78946040-78946062 TGAGAGAAGCAGGATAGGGGAGG - Intergenic
1070915091 10:80148371-80148393 AAGCGGAAGCAAGAGAGGGAAGG + Intergenic
1071031191 10:81183290-81183312 AAAGGAATACAGGATGGGGAGGG + Intergenic
1071178539 10:82956009-82956031 AAATGGAAGCAGAATTGGGCTGG - Intronic
1071468549 10:85962205-85962227 GAAGGGAAGGAGGGAAGGGAAGG - Intronic
1071487000 10:86108913-86108935 AGAGGGAAGCCGGACAGGGTGGG - Intronic
1071694814 10:87860720-87860742 AAAGGGGAGTAGATTAGGGAGGG - Exonic
1071718513 10:88120213-88120235 AAAGGGAAGCAGGAAGGCGGGGG + Intergenic
1072030938 10:91521854-91521876 AAAGGGGAACAGGATGGGGAGGG - Intergenic
1072105143 10:92266609-92266631 AATGGGAAGCGGGAGGGGGAAGG + Intronic
1072729902 10:97838837-97838859 AGTGGGAAGGAGGATTGGGAAGG + Intergenic
1073026847 10:100494007-100494029 AAAGGGAGGGAGGAAAGGGAGGG + Intronic
1073049282 10:100657004-100657026 AAAGGACAGCAGGAGAGCGAAGG + Intergenic
1073071221 10:100794443-100794465 GGAGGGAGGGAGGATAGGGAAGG - Intronic
1073092954 10:100959022-100959044 AAAGGGAAGCTGGGAAGGGAAGG + Intronic
1073377656 10:103050674-103050696 TGTGGGAAGCAGGATAGGGTAGG + Intronic
1073431727 10:103491615-103491637 AAAGGGAAGGAGGGAAGTGAAGG - Intergenic
1073582199 10:104678888-104678910 GAGGGAAAGCAGGACAGGGAAGG + Intronic
1073672190 10:105604570-105604592 TAAGGGAGACAGGGTAGGGAAGG + Intergenic
1073809464 10:107136856-107136878 AAAAGGAAGCAGGGGACGGAGGG - Intronic
1073954957 10:108859603-108859625 AAAGAGAGGCAGGAAAGGAAGGG + Intergenic
1074242681 10:111654584-111654606 GAAGGGAAGAAGGGAAGGGAAGG - Intergenic
1074359869 10:112816994-112817016 CGAGGGAAGCAGGACAGAGAAGG + Exonic
1074484312 10:113858213-113858235 AAAGGGAAGAAAGAAAAGGAAGG - Intronic
1074586227 10:114769490-114769512 AAAGGGAAGGAAGAGAGAGAAGG + Intergenic
1074878709 10:117634629-117634651 AGTGGGAAGTAGGATAGGGAAGG + Intergenic
1074992431 10:118722001-118722023 AAAGGGAAACTGGATAAGGTGGG - Intronic
1075404863 10:122188009-122188031 AAAGGCAGGCAGGATGTGGAAGG - Intronic
1075482738 10:122796420-122796442 AAAGAGAAGGAGGAGAGAGAAGG + Intergenic
1075768085 10:124910694-124910716 AAAAGGAAGAAAGAAAGGGAGGG - Intergenic
1075910768 10:126123729-126123751 AAAGGGAAGCAGGCGAGTGTGGG - Intronic
1076266049 10:129110660-129110682 AAAGCGGAGCAGGGTAGAGAAGG + Intergenic
1076541381 10:131217250-131217272 AGAGAGAAGCAGGATAGGGGAGG - Intronic
1076974003 11:157451-157473 AAAGGGAAGGAGGGAAGGAAAGG + Intergenic
1077584597 11:3440967-3440989 TAAGGGAAACAGGATATGGCAGG - Intergenic
1077663725 11:4090918-4090940 AAAGGGAAAAGTGATAGGGAGGG - Intronic
1077738688 11:4820496-4820518 GAAGGGAAGGAAGAAAGGGAAGG - Intronic
1077839495 11:5960242-5960264 AAAGGGGAGAGGGAGAGGGAGGG - Intergenic
1078350831 11:10591782-10591804 AGAGGAAAGGAGGACAGGGAAGG - Intronic
1078617261 11:12877770-12877792 AAAAGGAAGGAAGAAAGGGAGGG - Intronic
1078722379 11:13896937-13896959 AAAGGGAAGGAGGACTGTGAGGG + Intergenic
1078890984 11:15559058-15559080 AAAGAGAAGGAAGAAAGGGAGGG + Intergenic
1079116959 11:17646103-17646125 AAAGGGAGCCAGGATGGGCAGGG - Intronic
1079230838 11:18647433-18647455 AAAGTGGTGCAGGATATGGAAGG - Intergenic
1079513038 11:21233381-21233403 AAAGAAAAGGAGGAAAGGGAGGG - Intronic
1079704493 11:23596992-23597014 AAAAGGAAGCAGGGAAGGAAGGG + Intergenic
1079902842 11:26209137-26209159 AAGGGGTAGCAGGCTAGGGGAGG - Intergenic
1080021521 11:27565573-27565595 AAAGGGAAGGAGGATTGAGGAGG + Intergenic
1080316946 11:30959907-30959929 AAATGAAAGCAGGGAAGGGAAGG - Intronic
1080671540 11:34383895-34383917 AAAGGAAAGAAGGAAAAGGAAGG - Intergenic
1080706485 11:34700094-34700116 AAAGGAAATCAGTATAGGGAAGG - Intergenic
1080760610 11:35245483-35245505 CGAGGGGAGCAGGACAGGGAAGG - Intergenic
1081130509 11:39373440-39373462 AAAGGAAAGAAGGAAAGGAAAGG - Intergenic
1081593807 11:44445623-44445645 GAAGGCAGGCAGGAGAGGGAGGG + Intergenic
1081596570 11:44463585-44463607 CAAGAGAAGCAGGAGAGGCAAGG + Intergenic
1082143679 11:48641024-48641046 AGAGGGAAGAAGGAAAGGAAAGG - Intergenic
1082782670 11:57299842-57299864 AGAGGGAAGGAGGAGAGGAAGGG + Exonic
1083208823 11:61169963-61169985 GCAGGGAAGCAGGACTGGGAAGG + Intergenic
1083339663 11:61950880-61950902 AAAGGGAACCTGGAGTGGGAAGG + Intronic
1083353455 11:62047609-62047631 GCAGGGAAGGAGGACAGGGAAGG - Intergenic
1083574156 11:63777337-63777359 ACAGGGGAGCAGGGTAGAGATGG - Intergenic
1083597248 11:63923887-63923909 AAAAGGAAGAGGGATAGGGAAGG - Intergenic
1083951383 11:65958506-65958528 CAAGGGAAAGAGGATGGGGAGGG + Intronic
1084422608 11:69067812-69067834 AAAGGAAAGAAGGAAAGAGAAGG - Intronic
1084433755 11:69126179-69126201 AAAGGGAGGCAGGCAGGGGAGGG + Intergenic
1084884288 11:72193368-72193390 AAGGGGAGGAAGGAAAGGGAGGG + Intronic
1084884293 11:72193381-72193403 AAAGGGAGGGAGGAAAGGGAGGG + Intronic
1084884298 11:72193394-72193416 AAAGGGAGGGAGGAAAGGGAGGG + Intronic
1085287070 11:75370022-75370044 GGAGGGAAGCAGGGTAGGGCGGG - Intergenic
1085446495 11:76604326-76604348 AAAGGGAGGGAGAACAGGGATGG - Intergenic
1085596100 11:77811583-77811605 CAAGGGAAGGAAGATGGGGATGG + Intronic
1085682154 11:78586961-78586983 AAAGGGGATCAGCATAGGTAGGG - Intergenic
1085721883 11:78919640-78919662 AAAGGGAAACAGGGTCAGGAGGG + Intronic
1085777876 11:79382655-79382677 GAAGGGATGGAGGGTAGGGAGGG + Intronic
1085792225 11:79506085-79506107 AAGGTGAAGGGGGATAGGGAGGG + Intergenic
1086416127 11:86590539-86590561 GAAGGGAAGTAGGACAGGCATGG + Intronic
1088852842 11:113719474-113719496 GCAGGGAATCAGGATGGGGAAGG - Intergenic
1089201054 11:116724964-116724986 AGGGGGAAGGAGGACAGGGAGGG - Intergenic
1089324442 11:117647656-117647678 AAAGGGAAGGGGGATGAGGAGGG + Intronic
1089375106 11:117988510-117988532 AAAGGGAAGAGGGAGGGGGAGGG + Intronic
1089653678 11:119931905-119931927 GAAGGAGAGCAAGATAGGGAGGG + Intergenic
1090207061 11:124891289-124891311 AAAAAGAAGCAGGGTAAGGAGGG - Exonic
1090331067 11:125932569-125932591 AAGGGGAAGCAGGCTTGGGCTGG - Intergenic
1090403689 11:126464986-126465008 AAAGAGGAACAGGAGAGGGAAGG - Intronic
1090404051 11:126466748-126466770 GAAGGGAAGCAGGGAAGGGAGGG - Intronic
1090451471 11:126810101-126810123 AAAGTGAAGGATGATGGGGAGGG + Intronic
1090599007 11:128350272-128350294 GAAGGGATGAAGGATAGGAATGG - Intergenic
1090648254 11:128783944-128783966 GAAGGGAAGGAAGATAGGGAGGG + Intronic
1090841069 11:130487797-130487819 AATGGGAAGAAGGAAAGAGAAGG - Intergenic
1091035261 11:132227438-132227460 AAAGGGAAGCAGAATATGGAGGG + Intronic
1091182079 11:133614426-133614448 AAAGAAAAGAAGAATAGGGAAGG + Intergenic
1091192435 11:133706870-133706892 AAAGGGGAAAAGGAAAGGGAAGG + Intergenic
1091192474 11:133706991-133707013 AAAGGGAAAGGGGAAAGGGAAGG + Intergenic
1091857209 12:3749548-3749570 ACAGGGAAGCAGGAAAGGAGAGG - Intronic
1091913658 12:4251816-4251838 AAAGGGAAGGAAGACAGGGAGGG + Intergenic
1091990160 12:4948492-4948514 AAACGGAAGGAGGGAAGGGAAGG - Intergenic
1092001816 12:5038992-5039014 AGATGGAAGCAGGAGGGGGAGGG - Intergenic
1092065600 12:5587745-5587767 AAAGGGAAACCTGAGAGGGAGGG - Intronic
1092236597 12:6814516-6814538 AAAGGGAAGGAGGCAAGGGAAGG + Intronic
1093870185 12:24281742-24281764 AAAGTGAAGCATGAGGGGGATGG + Intergenic
1094094625 12:26689476-26689498 AAAGGGAAGGAAGGGAGGGAGGG + Intronic
1094349210 12:29504594-29504616 AAAGGGAAAAGGGGTAGGGAAGG + Intronic
1094597104 12:31875357-31875379 AAAGGCAAGGAGGAAAGGGAAGG + Intergenic
1094670535 12:32564011-32564033 AAAGGGGAGAGGGAGAGGGAGGG + Intronic
1095121928 12:38429650-38429672 AAAGAGAAGCAGCCTAGGAAAGG + Intergenic
1095169822 12:39020527-39020549 AGAGGGAAGGAGGGAAGGGAGGG + Intergenic
1095170286 12:39026879-39026901 ACAGGGAAGCAGAAGAGAGATGG + Intergenic
1095215426 12:39542003-39542025 AAAGGAAAGCAGCATAGGGTGGG + Intergenic
1095236653 12:39804834-39804856 AAAGAGAAGCAGGGTAAGTAGGG + Intronic
1095312466 12:40716324-40716346 AAGGGGAAGGAGGAAAGGAAGGG - Intronic
1096462522 12:51829809-51829831 AAAAGGAAGGAAGAGAGGGAGGG + Intergenic
1096522867 12:52193935-52193957 AAAGGGTAGCGGGTTAGAGAAGG + Intergenic
1096875230 12:54624864-54624886 GAAGGGAAGGAGGGAAGGGAGGG - Intergenic
1096933375 12:55241672-55241694 AAAGGGGAGCAGGAAAGTGCTGG + Intergenic
1097216635 12:57419125-57419147 AAAGGAAAGGAGAATATGGATGG - Intronic
1097475010 12:60042666-60042688 AAAGGGAAGGAAGGGAGGGAGGG + Intergenic
1097793029 12:63834659-63834681 TAAGAGAAGCAGGACAGGCATGG - Intergenic
1097829156 12:64205700-64205722 AAAGGGAAGGAAGGAAGGGAGGG + Intronic
1097829168 12:64205732-64205754 AAAGGGAAGGAAGGGAGGGAGGG + Intronic
1097879118 12:64671188-64671210 AAAGGGAGGCAGGATAGGGGAGG + Intronic
1098469378 12:70826129-70826151 AGAAAGAAGGAGGATAGGGAGGG + Intronic
1098545613 12:71707872-71707894 GAAGGGGAGCTGGAGAGGGATGG + Intergenic
1098560851 12:71870229-71870251 GAAGGGGAGGAGGAAAGGGAGGG - Intronic
1098919166 12:76287120-76287142 AAAGGGAAGGAAGGGAGGGAGGG + Intergenic
1099213260 12:79820160-79820182 AAAGGGAAGCAGACTAGGGTGGG + Intronic
1099234553 12:80068263-80068285 GAAGGGAAGGAGGAGAGAGAGGG + Intergenic
1099562184 12:84192541-84192563 AAAGGGAGGGAAGAGAGGGAAGG - Intergenic
1099831373 12:87847372-87847394 AGAGGGAAGCAAGACAGAGAGGG + Intergenic
1099933708 12:89101487-89101509 AAACTGAAGCAGGACAGGGCAGG + Intergenic
1100011314 12:89956973-89956995 AAAGGGAAGGAGGAGAGGAGAGG - Intergenic
1100142995 12:91641895-91641917 AAAGGAAGGAAGGAAAGGGAAGG - Intergenic
1100324727 12:93530234-93530256 AGAGGAAAGGAGGAAAGGGAAGG - Intergenic
1100326323 12:93543211-93543233 CAAGTGAAGCAGAATAGGGCAGG + Intergenic
1100787066 12:98089855-98089877 AAAAGGAAGAAGGGAAGGGAGGG + Intergenic
1100931139 12:99610583-99610605 AATGGGAAGCAGGAGAAAGAAGG + Intronic
1101220145 12:102630474-102630496 TGAAGGAAGCAGGATAGGGCAGG + Intergenic
1101520024 12:105474105-105474127 GAAGGGAAGCTGGATAAGGACGG - Intergenic
1101843128 12:108342030-108342052 AAAGGGGAGGAGGAGAGGGTGGG + Intergenic
1102078701 12:110080584-110080606 GAAGGGAGGCAGGGAAGGGAAGG - Intergenic
1102167941 12:110820973-110820995 AAAGGGGAGCTAGAGAGGGAGGG - Intergenic
1102323116 12:111956496-111956518 AAAGGGGAGAGGGAGAGGGAGGG - Intronic
1102421663 12:112808188-112808210 GAAGGGATGCAGGATGGGGCAGG + Intronic
1102586100 12:113924030-113924052 AAAGGGACTCAGGATAGGGCTGG + Intronic
1102588615 12:113940712-113940734 AAAGGGATGCAGGGAAGGGAAGG - Intronic
1102599407 12:114017822-114017844 GAGGGGAAGCAGGATAGGAAAGG - Intergenic
1102688522 12:114742471-114742493 AAAGGAAAGCAGGGTCTGGAGGG + Intergenic
1102745236 12:115243977-115243999 AAAGGGAGGGAGGGAAGGGAGGG + Intergenic
1102756159 12:115342567-115342589 AAAGGAGAGCAGGAAAGGGGGGG + Intergenic
1102780307 12:115558695-115558717 AAAGGGAAGGAGAATAGCAAAGG + Intergenic
1102898777 12:116619934-116619956 AAAGGAAAGGAGGAAAGGGAAGG + Intergenic
1103339926 12:120215844-120215866 GAAAGGAAGAAGGACAGGGAGGG + Intronic
1103445317 12:120990603-120990625 AAAGGGAGGAAAGATAGGAAAGG + Intronic
1103445321 12:120990621-120990643 AAAGGGAGGAAAGATAGGAAAGG + Intronic
1103586657 12:121961277-121961299 AAAGGGAAGGAAGGAAGGGAGGG - Intronic
1104144215 12:126017416-126017438 AAAGGGAGGCAGAAGAGAGAGGG - Intergenic
1104322513 12:127765160-127765182 AAAGGGAGGGAGTATAGCGAGGG + Intergenic
1104900244 12:132186144-132186166 AAAAGGAAGGAAGAAAGGGAGGG - Intergenic
1105757447 13:23481311-23481333 ACAGGGCAGCAGGAGAGTGAGGG - Intergenic
1105855567 13:24368871-24368893 CAAGGGAGGCAGGGTAAGGAGGG + Intergenic
1105892716 13:24693337-24693359 GAAGGGAAGGAGGAGAGGGAGGG - Intronic
1106114800 13:26808149-26808171 CCAGGGAAACAAGATAGGGAAGG - Intergenic
1106198997 13:27520691-27520713 AAAGGAAAGAAGGAAAGGGAGGG + Intergenic
1106790585 13:33151751-33151773 AACTGGCAGCAGGATAGAGAAGG + Intronic
1106841931 13:33693019-33693041 AAAAGGAATCAGAAAAGGGAGGG - Intergenic
1106929457 13:34648163-34648185 AAAGGGAAGGAGGGAAGAGAAGG + Intergenic
1107089702 13:36464710-36464732 ATTGGGAAGTAGGATATGGAAGG + Intergenic
1107314203 13:39113553-39113575 AAAGGAAAGCAGGAAAGGGATGG - Intergenic
1107813186 13:44219529-44219551 TCAGGGAGGCAGAATAGGGAGGG - Intergenic
1107850513 13:44567964-44567986 AAAAGGAAGAAGGAAAAGGAAGG + Intronic
1107918961 13:45183457-45183479 AAAGGGAAGCAAGACGGGGAAGG + Intronic
1108048380 13:46404842-46404864 GAAGGGAGGGAGGAAAGGGAGGG + Intronic
1108185047 13:47880383-47880405 AGAGGGAAGGAGGATGGGGTGGG + Intergenic
1108396682 13:49996997-49997019 AAGGGGAAGCGGGAGAGGGAAGG + Intronic
1108820840 13:54347369-54347391 AAAAGGAAGAAGAATAAGGAAGG - Intergenic
1109247972 13:59980588-59980610 TAAGGAAAGAAGAATAGGGAAGG + Intronic
1109869868 13:68320880-68320902 AAATGGAAGCACCATTGGGAGGG + Intergenic
1110136714 13:72076596-72076618 AAAGAGCAGGAGGATAGAGATGG + Intergenic
1110182652 13:72635889-72635911 CAAGGGAAGCAAGAGAGAGAAGG - Intergenic
1110413000 13:75223635-75223657 AAAGGAAAGGAAGATTGGGAAGG + Intergenic
1110490339 13:76096080-76096102 AAAGGAAAGAAGCAAAGGGAAGG - Intergenic
1110519222 13:76455797-76455819 AAAGAGGAGGAGGATGGGGAGGG + Intergenic
1110519229 13:76455827-76455849 GAAGAGAAGCAGGAGAGGGAGGG + Intergenic
1110555948 13:76859143-76859165 AAAGGGGAGGAGGAAAGGGAAGG + Intergenic
1110563005 13:76929354-76929376 AAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1110916905 13:81031715-81031737 AAGGGGAAGCAAGAGAGTGAAGG + Intergenic
1111108458 13:83675614-83675636 CAAGGGGGGCAGGATAAGGAGGG + Intergenic
1111390100 13:87582645-87582667 AAAGAGAGGAAGGAAAGGGAAGG - Intergenic
1111396346 13:87672929-87672951 AAGGGGAGGGAGGAGAGGGAAGG - Intronic
1112229988 13:97580313-97580335 GAAGGGAAGCTGGAGAAGGAAGG - Intergenic
1112250447 13:97774471-97774493 AGATGGAAGAAGGAGAGGGAGGG - Intergenic
1112446800 13:99471765-99471787 GAAGGGAGGGAGGAGAGGGAAGG + Intergenic
1112446809 13:99471791-99471813 GAAGGGAGGGAGGAGAGGGAAGG + Intergenic
1112527572 13:100166587-100166609 AAAGGAATGCAGGCTAGGCACGG - Intronic
1112671545 13:101645105-101645127 AAAGGTAGGCAGGTTAGGGCTGG + Intronic
1113030712 13:105990814-105990836 AAAGATAAACAGGAAAGGGAAGG - Intergenic
1113636356 13:111921534-111921556 TAAAGGAAGCAGGAACGGGAGGG - Intergenic
1114742532 14:25112771-25112793 AAAGGGAAAAAGGATGTGGAAGG - Intergenic
1115084171 14:29493284-29493306 AAAGGGAAACAGAAGAGGAAGGG + Intergenic
1115127512 14:30014091-30014113 TAAGGAAAGCAGAATAGGGCAGG + Intronic
1115484457 14:33896897-33896919 CATGGGAAACAGGAAAGGGAAGG + Intergenic
1115550550 14:34501170-34501192 AAAGAGAAGAAAGAAAGGGAAGG + Intergenic
1115620112 14:35132798-35132820 AAAGGGAAGAAGGAAAGGAAAGG + Intronic
1115784011 14:36804214-36804236 CTAGGGAAGAAGGAAAGGGATGG - Intronic
1115834143 14:37378626-37378648 GGAGGGAAGGAGGAAAGGGAGGG + Intronic
1115881972 14:37929528-37929550 AAAGGAAAACTTGATAGGGAGGG + Intronic
1115939229 14:38589969-38589991 GAAGGGAAGGAAGAAAGGGAAGG + Intergenic
1115939236 14:38589994-38590016 GAAGGGAAGGAAGAAAGGGAAGG + Intergenic
1115939243 14:38590019-38590041 GAAGGGAAGGAAGAAAGGGAAGG + Intergenic
1115939250 14:38590044-38590066 GAAGGGAAGGAAGAAAGGGAAGG + Intergenic
1115939257 14:38590069-38590091 GAAGGGAAGGAAGAAAGGGAAGG + Intergenic
1115939264 14:38590094-38590116 GAAGGGAAGGAAGAAAGGGAAGG + Intergenic
1116112351 14:40602717-40602739 AAAGTGAAGCTGTATAGGTAGGG - Intergenic
1116878042 14:50133608-50133630 AAAGTGAAGCAAGATATAGAAGG - Intronic
1117202455 14:53406183-53406205 AAAAGGAAGAACTATAGGGAAGG - Intergenic
1117427488 14:55615852-55615874 AAAAGGAAGAAAGAAAGGGAAGG - Intronic
1117435877 14:55714865-55714887 AAAGGAAAGCAAGTCAGGGAAGG - Intergenic
1117602064 14:57386310-57386332 AAAAGGAGGCAGGAAAAGGATGG + Intergenic
1118459543 14:65976004-65976026 GAAGGGAAGCAGGAGAAGGAGGG + Intronic
1118586692 14:67359970-67359992 GCAGGGAAGCTGGATGGGGAGGG - Exonic
1118658326 14:67978516-67978538 GAAGGGAAGCGGGATATGTATGG - Intronic
1118731356 14:68669340-68669362 AGAGGGAAGCAGGGGAGGCAGGG - Intronic
1118767399 14:68919074-68919096 AAAGGGGAGGAGGGCAGGGAAGG - Intronic
1118855265 14:69616255-69616277 AAAGGGTAGCAAGAAAGGGGAGG - Intronic
1118970381 14:70631849-70631871 GAAGGGAAGAAGGGAAGGGAAGG + Intergenic
1118970387 14:70631867-70631889 GAAGGGAAGAAGGGAAGGGAAGG + Intergenic
1119327002 14:73766029-73766051 GAAGGGAAGCAGGGTAGAGCCGG - Intronic
1119343274 14:73899601-73899623 AATGAGAAGCAGCGTAGGGAGGG + Intronic
1119706992 14:76789094-76789116 AAAGGGAACGAGGAGGGGGAAGG + Exonic
1119707477 14:76793315-76793337 AAAGGAAAGAAGGAAAGGAAAGG + Intronic
1119949553 14:78730343-78730365 AAAGGTAAGCAGGACAGGAGAGG - Intronic
1120431701 14:84426335-84426357 AAAGGAAAGAAGGTAAGGGAAGG - Intergenic
1120483940 14:85086475-85086497 AAAGGGAAGAAAGAAAGGGAGGG - Intergenic
1120583909 14:86287344-86287366 GAAGGGAAGAAGGAAAGAGAAGG + Intergenic
1120895407 14:89527028-89527050 ACAGGAAAGGAGGATAGGGAGGG + Intronic
1120935806 14:89893693-89893715 AAAAGGAAGCAGGATTGGGCAGG - Intronic
1120984689 14:90324231-90324253 AAAATGAAGCAGGAGAGGTAGGG + Intronic
1121498357 14:94413473-94413495 CCAGGGAAGCAGGACAGGGGAGG - Intergenic
1121529958 14:94645259-94645281 AAAGGAAATAAGGAAAGGGAAGG + Intergenic
1121593325 14:95137363-95137385 AAAGGGAAGGGGGAAGGGGAAGG + Intronic
1121741825 14:96257963-96257985 GGAGGGAAGGAGGGTAGGGAGGG + Intronic
1121756619 14:96408244-96408266 AAAAGGGAGCAGGCTGGGGATGG - Intronic
1121804049 14:96798450-96798472 AAAGGGACACAGGAAAGGGAAGG - Intronic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1122387505 14:101359148-101359170 AAAGGGAAGGATGACAGAGAAGG + Intergenic
1122392546 14:101400026-101400048 AGAGGGAAGGAGGAAAGGGAGGG + Intergenic
1122487989 14:102094535-102094557 AAGGGCATGCAGGAGAGGGAGGG + Intronic
1122546523 14:102525844-102525866 AAAGGAAGGAAGGAAAGGGAGGG - Intergenic
1122657627 14:103273125-103273147 AAAGGAAAGAAGGAAAGGAAAGG + Intergenic
1123432453 15:20230090-20230112 GAAGGGAAGAGGGAAAGGGAAGG + Intergenic
1123496525 15:20832718-20832740 AGAGGCAAGCAGACTAGGGAGGG - Intergenic
1123508061 15:20965737-20965759 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1123553762 15:21406308-21406330 AGAGGCAAGCAGACTAGGGAGGG - Intergenic
1123565280 15:21539478-21539500 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1123590004 15:21843673-21843695 AGAGGCAAGCAGACTAGGGAGGG - Intergenic
1123601543 15:21976762-21976784 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124613155 15:31222977-31222999 GAAGGGAGGCAGGAGAGGCAGGG + Intergenic
1124647671 15:31450432-31450454 AAAGGGAAGGAAGACGGGGAAGG + Intergenic
1124788997 15:32709004-32709026 AAAGGGAAGGAAGGGAGGGAAGG - Intergenic
1124847058 15:33301389-33301411 AAAGTGAGACAGGAAAGGGAAGG - Intergenic
1125751992 15:42035527-42035549 AAAGGCAGGCAGGATGGGGCAGG + Intronic
1125931475 15:43603231-43603253 AAAGCAAAACAGGTTAGGGATGG - Exonic
1126047874 15:44660776-44660798 AAAGGGAAGCGGGAAGAGGAGGG - Intronic
1126205775 15:46043030-46043052 AAAGGGTATCAGGAGAGGAAAGG - Intergenic
1126251605 15:46574117-46574139 AAAGGAAAGAAGGAAAGGAAGGG + Intergenic
1126315261 15:47362973-47362995 AAAGGGCAGCAGTGTTGGGAAGG - Intronic
1126431918 15:48594996-48595018 AAAGAGAAGCAGTTTAAGGAGGG + Intronic
1126644202 15:50858891-50858913 AAATGGAAGCTGGCTAAGGAGGG - Intergenic
1126684204 15:51233181-51233203 ATAGGGAAGGAGGATGGGGGAGG - Intronic
1127737555 15:61858380-61858402 AAAGGAATACATGATAGGGAGGG - Intronic
1127810572 15:62561741-62561763 AAAGGGAAGGAGGCCAGGGTGGG - Intronic
1128419043 15:67474114-67474136 AGAGGGATGCAGGAGAGGAAAGG + Intronic
1128596917 15:68960756-68960778 CAAGGGGAGCAGGACATGGAGGG - Intronic
1128795754 15:70465388-70465410 AATGGGAAGCAGGTTTGGGCAGG - Intergenic
1128985450 15:72217247-72217269 AGAGGGAAGGAGAGTAGGGATGG + Intronic
1129005361 15:72368534-72368556 AAAGGGAAGTAGAACACGGAAGG - Intronic
1129033240 15:72633362-72633384 ACAGGGCAGCAGGAGAGAGAAGG + Intergenic
1129054444 15:72808973-72808995 GCAGGGAAGCAGGACAGGGAAGG + Intergenic
1129099205 15:73242840-73242862 AAATGGAAGCAGGGCAGGAAAGG + Intronic
1129216644 15:74103868-74103890 ACAGGGCAGCAGGAGAGAGAAGG - Intronic
1129219065 15:74120993-74121015 GAAGGGAAGAGGGATAGGGTGGG - Intronic
1129657460 15:77533720-77533742 AAAGGAAAGCAGGGGAGGGAAGG - Intergenic
1130011451 15:80155715-80155737 CAAGGGGGGCAGGGTAGGGAGGG + Intronic
1130147725 15:81287267-81287289 AAAAGGTAGCAGGCTTGGGAGGG + Intronic
1130391523 15:83459974-83459996 AAAGGGAAAGGGGAAAGGGAAGG - Intronic
1130411109 15:83649469-83649491 TGAGGGAAGCAGGATAGGTAAGG - Intergenic
1130574557 15:85080389-85080411 AAAAGCAAGCAGCTTAGGGAGGG - Intronic
1130982876 15:88824919-88824941 ACAGGGTAACATGATAGGGAGGG + Intronic
1131449309 15:92525961-92525983 GAAGGGCAGGAGGAAAGGGAGGG - Intergenic
1131662148 15:94528997-94529019 AACTGGAATCAGGATAGGAAGGG - Intergenic
1131689765 15:94814000-94814022 AAAGGGAAGGAAGAAAAGGAAGG + Intergenic
1131769340 15:95718278-95718300 ATAGAGAAAGAGGATAGGGAAGG - Intergenic
1132137755 15:99360153-99360175 ACAGGGATGCAGGGTATGGATGG - Intronic
1132333441 15:101027925-101027947 AGAGGGAAGAAGGAAGGGGAGGG - Intronic
1132352178 15:101146693-101146715 AGAAGGAAGGAGGACAGGGAGGG + Intergenic
1202962108 15_KI270727v1_random:133504-133526 AGAGGCAAGCAGACTAGGGAGGG - Intergenic
1202973651 15_KI270727v1_random:266585-266607 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1132705742 16:1242417-1242439 AAGGGGGCTCAGGATAGGGAAGG - Exonic
1132918051 16:2364769-2364791 GAAGGGAAGGAGGGGAGGGAGGG + Intergenic
1132979832 16:2731723-2731745 AAAGAGAAAAAAGATAGGGAGGG + Intergenic
1133151914 16:3839750-3839772 AAAGGAAGGGAGGAAAGGGAAGG + Intronic
1133485559 16:6215228-6215250 GAGGGGAAGAAGGAGAGGGAAGG + Intronic
1133593956 16:7272840-7272862 GAAGGGAAGAAGGGAAGGGAGGG - Intronic
1133594030 16:7273093-7273115 AGAGGGAAGGAGGAAAGGGAGGG - Intronic
1133594038 16:7273118-7273140 GCAGGGAAGGAGGAAAGGGAGGG - Intronic
1133656708 16:7872039-7872061 GGAGGGAAGAAGGACAGGGAAGG - Intergenic
1133786974 16:8981480-8981502 AAAGGGGAGAGGGAGAGGGAGGG - Intergenic
1133813215 16:9177309-9177331 AAAAGGAAACAGGAAAGGAAAGG - Intergenic
1134242453 16:12515986-12516008 AAGGGGAAGCAGGGGAGGGGAGG + Intronic
1134385501 16:13768269-13768291 TAAGCAAAGCAGGAAAGGGATGG + Intergenic
1134765689 16:16755709-16755731 AAGGGGAAGAAGGAGAGGAAGGG - Intergenic
1134787142 16:16954867-16954889 AAATGGAGGAAGGGTAGGGATGG + Intergenic
1134891573 16:17845913-17845935 ACGGGGAAGGAGGACAGGGAGGG + Intergenic
1134980361 16:18603504-18603526 AAGGGGAAGAAGGAGAGGAAGGG + Intergenic
1135041300 16:19119249-19119271 AAAGTGAAGCAAGAGAGGGAAGG + Exonic
1135139373 16:19908443-19908465 ACAGGGATGGAGGATGGGGAAGG + Intergenic
1135728172 16:24873147-24873169 AAAGGAAAGAAGGAAAGGAAAGG + Intronic
1135823130 16:25702541-25702563 AAAGGGAGACAGGAAAGGGGAGG - Intronic
1135855125 16:26002645-26002667 AAAGGGAAGAAAGAGAGAGAGGG + Intronic
1136230803 16:28884132-28884154 AAAGGCAAGGAGGAAAGGCAAGG - Intronic
1136299670 16:29325336-29325358 AAAGAGAAGCAGGCCAGGCATGG - Intergenic
1136396018 16:29992899-29992921 AAAGGGAACCAGGCCAGGGGAGG + Exonic
1136523799 16:30814758-30814780 AAAGGAAAGAAAGAAAGGGAAGG - Intergenic
1136730339 16:32405923-32405945 GAAGGGAAGAAGGGAAGGGAAGG - Intergenic
1137767832 16:50991511-50991533 AGAGGGGGGCAGGAGAGGGAAGG + Intergenic
1137776668 16:51060721-51060743 AAAGGGAAGGAAGGGAGGGAGGG + Intergenic
1137800988 16:51262049-51262071 GAAGGGAAGGAAGAGAGGGAGGG - Intergenic
1137921963 16:52498762-52498784 ACGGGGAAGCAGGATATGCACGG - Intronic
1138162558 16:54768480-54768502 AAAGGAAAGCAGGTTAGGAGGGG + Intergenic
1138407232 16:56806134-56806156 GAAGAGAAGGGGGATAGGGAAGG - Intronic
1138486713 16:57349886-57349908 AAAAGGAAGGAAGAAAGGGAGGG - Intergenic
1138835414 16:60428876-60428898 AAAGAGAAGGAGGATGGGGTGGG + Intergenic
1138957681 16:61990990-61991012 AAAGGGAGGAAGGAAAGGAAGGG + Intronic
1139004276 16:62551563-62551585 AAGGGGAAAAAGGAAAGGGAAGG - Intergenic
1139101972 16:63778531-63778553 ACAGGGAATTAGGATTGGGAGGG - Intergenic
1139308669 16:66009689-66009711 AAAGGGAAGAAGGTCAGGCATGG + Intergenic
1139320395 16:66109658-66109680 GAAGGGAAGAAGGAAGGGGAGGG + Intergenic
1139349033 16:66323679-66323701 AAAGAGAAGCAGGGGAGGGAGGG - Intergenic
1139711568 16:68780262-68780284 ACAGGGAGGAAGGATAAGGAGGG - Intronic
1140018683 16:71215257-71215279 AAAGGGAGGAAGGAGGGGGAAGG + Intronic
1140131586 16:72166593-72166615 AGGGGGAAGCAGGACAGGGAAGG + Intronic
1140202008 16:72902602-72902624 TAAGGAAAGCAGGAAAAGGAGGG - Intronic
1140254248 16:73321258-73321280 ACAGGGAAGCAGGATAGCTCAGG + Intergenic
1140634790 16:76899173-76899195 ATAGGGTAGCAGAATAGAGAAGG + Intergenic
1140752837 16:78041535-78041557 AAAGGAAAGCTGAAAAGGGAAGG + Intronic
1140765769 16:78155273-78155295 AAAGGGAAGGAAGGAAGGGAAGG + Intronic
1140905882 16:79408681-79408703 AAAGGGATGGAGGGGAGGGAGGG - Intergenic
1141047998 16:80734542-80734564 ATAGGGAAGCAGGTTTGGGAAGG + Intronic
1141274184 16:82570170-82570192 AAGGGGAATGAAGATAGGGAAGG + Intergenic
1141373431 16:83508118-83508140 GAAGGGAGGAAGGAAAGGGAAGG + Intronic
1141440634 16:84027564-84027586 AGAGGGCTGCAGGAAAGGGACGG - Intronic
1141713912 16:85716278-85716300 GGAGGGAAGGAGGAGAGGGAAGG + Intronic
1141846199 16:86610745-86610767 GAAGGGAGGCAGGGAAGGGATGG + Intergenic
1142215034 16:88825893-88825915 AACGGGAAGCAAGGTGGGGACGG - Intronic
1142446260 16:90140234-90140256 AAAGGGAAGGAGGGAAGGAAAGG - Intergenic
1202996061 16_KI270728v1_random:111384-111406 GAAGGGAAGAAGGGAAGGGAAGG + Intergenic
1203022748 16_KI270728v1_random:423726-423748 GAAGGGAAGAAGGGAAGGGAAGG + Intergenic
1142461245 17:95229-95251 AAAGGGAAGGAGGGAAGGAAAGG + Intergenic
1142601213 17:1053795-1053817 AACGGGAAGCAGGAGAGGGAGGG + Intronic
1143707784 17:8711531-8711553 AGTGGGAATCAGGAGAGGGAGGG - Intergenic
1143872999 17:9971099-9971121 AAAGGGAAGGATGAAAGGCAGGG + Intronic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1143963433 17:10739028-10739050 GAAGGGAAGGAGGAGAGGAAGGG - Intergenic
1143963438 17:10739045-10739067 GAAGGGAAGGAGGAGAGGAAGGG - Intergenic
1144034345 17:11352136-11352158 TAAGGGAAGGAGGAGAGAGAGGG + Intronic
1145028721 17:19488555-19488577 AAAGGGAAGCCAGACTGGGAGGG + Intergenic
1145807337 17:27744240-27744262 GAAGGGAAGCAAGCGAGGGAGGG - Intergenic
1145916278 17:28575903-28575925 AAAGGGAAGCTGGAAAGGCCAGG - Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146986148 17:37220366-37220388 AAAGGGAAGCAGGAAAAAGCAGG + Intronic
1147242465 17:39099460-39099482 CATGGGATGCAGGATAGGGAAGG + Intronic
1147532946 17:41297472-41297494 AAAAGGAAGAAGGAGAGAGAGGG - Intergenic
1147599724 17:41738424-41738446 GATGAGAAGCAGGAGAGGGAGGG - Intergenic
1147626586 17:41904306-41904328 AAAGGGAAGAAGGAAAGGGAAGG + Intronic
1147906333 17:43825500-43825522 AAAGGGAACCAGGGGAAGGAAGG + Intronic
1147977200 17:44254692-44254714 CAAGGGCAGGAGGATGGGGAAGG + Intronic
1148273835 17:46285212-46285234 AAAGAAAACCAGGATAGGTATGG - Intronic
1148486930 17:47996586-47996608 GAGGGGAAGGAGGATAGGGGTGG - Intergenic
1148538702 17:48462520-48462542 AAAGGGAGGCAGGAGAGAGAGGG + Intergenic
1148621596 17:49038611-49038633 AAAGGGAGGGCAGATAGGGAGGG + Intronic
1148648182 17:49230944-49230966 AAAGGGTAGCAGGGTGGGGATGG + Intergenic
1148781316 17:50123666-50123688 GAGGGGGAGGAGGATAGGGAAGG - Intronic
1148824421 17:50381875-50381897 AAATGGAAACAGGATATGAAGGG - Exonic
1148922443 17:51050969-51050991 GAAGGGAGGGAGGAAAGGGAAGG + Intronic
1149042636 17:52208342-52208364 AAAGGAAAGAAAGAAAGGGAAGG - Intergenic
1149091714 17:52790910-52790932 ACAGGGAAGAAGGATATGGGTGG - Intergenic
1149261318 17:54882824-54882846 AAAGGAAAGAAGGAAGGGGAGGG + Intergenic
1149364484 17:55928531-55928553 AAAATAAAGCAGGATAGGGGTGG + Intergenic
1149417174 17:56471328-56471350 AAAGGAAAGCAGGGAAGAGAAGG - Intronic
1149424942 17:56545961-56545983 GAAGGGAAGGAAGAGAGGGAGGG + Intergenic
1149658116 17:58320717-58320739 AGAGGGAAGAGGGATAGGGAAGG + Intronic
1149709050 17:58721909-58721931 AAAAGGAGGAAGGTTAGGGAAGG + Intronic
1149826109 17:59829776-59829798 TAATGGGAGTAGGATAGGGAAGG + Intronic
1150138114 17:62706876-62706898 AAAGGGAAGGAGGAGAGGGAAGG + Intronic
1150195284 17:63291542-63291564 CAAGGGTAGCAGTGTAGGGATGG + Intronic
1150409221 17:64929368-64929390 AAAGAAAAACAGGATAGGTATGG + Intergenic
1150493261 17:65588837-65588859 AAGGGGAAGGGGGAAAGGGATGG - Intronic
1150761442 17:67965709-67965731 AAAGAATAACAGGATAGGGATGG + Intronic
1151310515 17:73289825-73289847 AAAGGAAAGAAGGAAAGGAAAGG + Intronic
1151352381 17:73539444-73539466 AGAGGCCAGCAGGAGAGGGAGGG + Intronic
1152037731 17:77883668-77883690 CAAGGGAGGAAGGCTAGGGAGGG - Intergenic
1152195488 17:78915916-78915938 AATGGGGATGAGGATAGGGAAGG + Intronic
1152609187 17:81307369-81307391 AAAGGGAAGGAGGAGGGGGAGGG - Intergenic
1152628106 17:81397541-81397563 AAGGGAAAGAAGGAAAGGGAGGG - Intronic
1153021645 18:634821-634843 AAAGGGAATGAGGGGAGGGATGG - Intronic
1153210504 18:2758220-2758242 AAAGGAAAACAGGAAAGAGAAGG - Intronic
1153576546 18:6527513-6527535 GAAGGGAAGCAGGAATAGGAGGG + Intronic
1154095785 18:11413771-11413793 GAAGGAAAGCAGGAAAGGAAGGG - Intergenic
1154305767 18:13229709-13229731 AAAGAGTAGAAGGAGAGGGAAGG - Intronic
1154454439 18:14508401-14508423 AGAGGCAAGCAGACTAGGGAGGG - Intronic
1155008546 18:21751679-21751701 AAAGGGAAGAAAGAAAGGAAGGG - Intronic
1155922127 18:31614113-31614135 AAAGGGAAGGAAGGGAGGGAGGG + Intergenic
1156031354 18:32716713-32716735 AAAGTGAAGCAAGCTAGGGCTGG - Intronic
1156076815 18:33288469-33288491 AAATGGAAGGAAGAAAGGGAAGG - Intronic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1156576210 18:38318999-38319021 GAAGGGAAGCAGGAAAGAGAAGG + Intergenic
1156700497 18:39819070-39819092 GAAGGGAAGCGGGGAAGGGAGGG + Intergenic
1156764292 18:40632618-40632640 GAAGGGAAGGAGAAGAGGGAAGG + Intergenic
1157276158 18:46312291-46312313 CAAGGGAAGGAGGAGAGGAAAGG - Intergenic
1157781852 18:50446476-50446498 AAGAGGAAGCATGATAGGAAAGG - Intergenic
1157987512 18:52455884-52455906 ATACGGAAGTAGGGTAGGGATGG - Intronic
1158236675 18:55323137-55323159 AAAGGAAAGAAAGAAAGGGAGGG + Intronic
1158334927 18:56405723-56405745 AAAGGGAAGGAAGGAAGGGAAGG + Intergenic
1158423128 18:57313513-57313535 AAAGGAGAGCAGGAGAAGGAAGG + Intergenic
1158477444 18:57792844-57792866 AAAGACAAACAGGATAGGGAGGG + Intronic
1158639542 18:59191871-59191893 TAAGAGAAGCAGGATAAGAAAGG - Intergenic
1158868270 18:61659055-61659077 AGAGGGAGGCAGGAGAGCGAGGG + Intergenic
1159301000 18:66567359-66567381 AAGGGGGAGGAGGAGAGGGAGGG + Intronic
1159654987 18:71022611-71022633 AGAGGGAGGCAGGAGAGTGAGGG - Intergenic
1159890957 18:73952807-73952829 AAAAGGAAGCTGGAAAGAGATGG + Intergenic
1160109933 18:76016684-76016706 AAAGAAAAGAAGGAAAGGGAGGG + Intergenic
1160136099 18:76273064-76273086 TAAGGGCAGCAGGATAAAGATGG - Intergenic
1160462931 18:79053024-79053046 CGATGAAAGCAGGATAGGGACGG - Intergenic
1160589368 18:79934371-79934393 AAAGGGAAGCAGGATCTGCCTGG - Intronic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160650946 19:227596-227618 AAAGGGAAGGAGGGAAGGAAAGG + Intergenic
1160918671 19:1509675-1509697 GAAGGGAAGGAAGAAAGGGAAGG + Intronic
1161100289 19:2418362-2418384 AAAGGGAGGGAGGGAAGGGAAGG - Intronic
1161100350 19:2418517-2418539 GAAGGGAGGGAGGAGAGGGAAGG - Intronic
1161100357 19:2418535-2418557 AAAGGGAGGGAGGGAAGGGAAGG - Intronic
1161143071 19:2660300-2660322 ACAGGGAATCAGGATTGGAAAGG - Intronic
1161377032 19:3944891-3944913 AAAGGGAAGGAAGGGAGGGAGGG + Intergenic
1161789429 19:6350143-6350165 AAAGGAAAGAAGGGAAGGGAAGG + Intergenic
1162120658 19:8465053-8465075 AAAGAAAAGCAGGGTAGGGAGGG - Intronic
1162873697 19:13604784-13604806 GAAGGGAAGGAGGAAGGGGAAGG + Intronic
1163812261 19:19440925-19440947 AAAGGGAAGGAAGAAAAGGAAGG - Intronic
1163812266 19:19440948-19440970 AAAGGGAAGGAAGAAAAGGAAGG - Intronic
1164421669 19:28099035-28099057 AAAGAAAAGCAGGAGAGGGCCGG + Intergenic
1164595718 19:29529675-29529697 AAAGGGAAGCCGGATCGTGATGG + Intronic
1164689282 19:30197478-30197500 AAAGGGCAGAACAATAGGGATGG + Intergenic
1165060019 19:33200625-33200647 AAAGGGAACCAGGCTGGGGCCGG + Intronic
1165087838 19:33363724-33363746 AGAGGGAAGTGGGAGAGGGAAGG - Intergenic
1165141338 19:33701927-33701949 AAAGGAAAGAAGGACAGAGAAGG - Intronic
1165277028 19:34763109-34763131 CAAGGGAGGCAGCATAGGAATGG + Intronic
1165325381 19:35111619-35111641 ACAGGGAAGCAGGAAAGGGCAGG - Intergenic
1165355939 19:35304151-35304173 ATAGGTCAGCAGGAGAGGGACGG - Intronic
1166036006 19:40169096-40169118 AAAGAGAAGCAGAACAGGGCTGG + Intergenic
1166061562 19:40328751-40328773 AAAGGCTCCCAGGATAGGGAGGG - Intronic
1166201214 19:41238968-41238990 AAAGGGAAGCTAGAAGGGGATGG + Intronic
1166348659 19:42182946-42182968 AAAGGGAAGCAGGTTAGAGAAGG + Intronic
1167047772 19:47060890-47060912 AAAAGGAAGAAGGGTGGGGAAGG + Intergenic
1167137442 19:47625654-47625676 AAAGGAAAGAAGGTGAGGGAAGG + Intronic
1167314089 19:48753716-48753738 AAGGGGGGGCAGGATAAGGAGGG + Intronic
1168099647 19:54134215-54134237 AGAGGGAAGGTGGAGAGGGAGGG - Intergenic
1168338376 19:55609808-55609830 AGAGAGAAGCATGATGGGGAGGG - Intronic
1168433805 19:56302320-56302342 AAAGGGAAGGAGGAAGGGGAGGG - Intronic
1168726498 19:58585625-58585647 AAAGGGAAAGAGGAAAGGAAAGG - Intergenic
925213577 2:2072781-2072803 ACAGGGCAGCAGGAGAGAGAAGG - Intronic
925392745 2:3508904-3508926 AAAAGGAAGAAGGGAAGGGAAGG + Intronic
925409960 2:3634244-3634266 AAAGGCAGCCAGGATAGGGCAGG + Intronic
925545464 2:5011235-5011257 AGAAGGAAGGAGGAGAGGGAGGG - Intergenic
925575869 2:5359068-5359090 AAGGGGAAGCAGGAGAGAAAAGG + Intergenic
925827437 2:7863244-7863266 AAAAATAAGCAGGATAGGAAAGG + Intergenic
926394858 2:12430440-12430462 GAAAGGAAGGAGGAGAGGGAGGG + Intergenic
926683525 2:15681054-15681076 AAAGGGAGGGGGGAGAGGGAGGG + Intergenic
926819462 2:16836764-16836786 AAAGAAAAGAAGGAAAGGGAAGG - Intergenic
926920767 2:17937500-17937522 AAAAGGAAGGAGGGGAGGGAGGG - Intronic
927097600 2:19759408-19759430 AATAAGAAGCAGGTTAGGGACGG + Intergenic
927121383 2:19966917-19966939 GAAAGGAAGGAGGAAAGGGAAGG + Intronic
927471840 2:23383564-23383586 AAAGGGGAGCAGGAGTGGGGGGG - Intergenic
927670895 2:25068036-25068058 ACAGGGAAGCAGGTAAGAGATGG - Intronic
927688337 2:25188695-25188717 AAAAGGAAGGAAGAGAGGGAGGG - Intergenic
928018285 2:27679908-27679930 TGAGGGAAGCAGGAGAGGGCAGG + Intronic
928177969 2:29047857-29047879 AAAATGTAGCAGGATGGGGAAGG + Intronic
928232063 2:29506765-29506787 AAAGTTAAGCAGGATTTGGATGG + Intronic
928520636 2:32084908-32084930 AAAGGGAAGGAGCATGGGAATGG + Intronic
928602345 2:32915904-32915926 GAAGGTAAGAAGGAGAGGGAGGG - Intergenic
928713982 2:34039109-34039131 AGAGGGAAGAAGGAGGGGGAAGG - Intergenic
928823615 2:35392140-35392162 AGAGGGAAAGAGGACAGGGAGGG + Intergenic
929301025 2:40303838-40303860 AACGTGAAGCAGGAAAAGGAAGG + Intronic
929733234 2:44518593-44518615 AAAGGGAAGCAGCTTAAGGTAGG - Intronic
930425735 2:51210128-51210150 AAATGGAAGCTGGAGAGGTAAGG + Intergenic
930712599 2:54563188-54563210 AGAGGGAACCAGGTTAGGGTGGG - Intronic
931000173 2:57770874-57770896 AAAGGGAAGAAGGAGAAAGAAGG - Intergenic
931114837 2:59153408-59153430 AAAGGGAGACAGGAGAGGAAAGG - Intergenic
931189689 2:59988230-59988252 CAAGGGAAGGGGGATAAGGATGG + Intergenic
931340696 2:61398365-61398387 AAAGAGAAGGAGGAGAGAGATGG + Intronic
931617556 2:64175697-64175719 AAAGAAAAGGAGGATAGAGAAGG - Intergenic
931682042 2:64759019-64759041 AAAGGGGAGCAGGAAGGTGATGG - Intergenic
931937156 2:67211680-67211702 AAAGGAAGGAAGGAAAGGGAAGG + Intergenic
931937160 2:67211693-67211715 AAAGGGAAGGAAGAAAGGGAGGG + Intergenic
932112319 2:69012794-69012816 CAAAAGATGCAGGATAGGGAAGG + Intergenic
933416932 2:81998270-81998292 TAAGGGAAATAGGATAGGGCAGG + Intergenic
933751306 2:85603488-85603510 AAAAGGAAACAGGATAGTGTGGG + Intronic
934047333 2:88183594-88183616 AGAGGGAAGAAGGAGAGCGAGGG - Intronic
934121830 2:88847650-88847672 GAATGGAAGAAGGAGAGGGAAGG + Intergenic
934167648 2:89309569-89309591 AAATGTAGGCAAGATAGGGAGGG + Intergenic
934199636 2:89873014-89873036 AAATGTAGGCAAGATAGGGAGGG - Intergenic
934315373 2:91913253-91913275 GAAGGGAAGAAGGGAAGGGAAGG + Intergenic
934626537 2:95861660-95861682 AAAGGAAAGCAGGAAAAGAAGGG + Intronic
934807021 2:97239636-97239658 AAAGGAAAGCAGGAAAAGAAGGG - Intronic
934830485 2:97517539-97517561 AAAGGAAAGCAGGAAAAGAAGGG + Intronic
935305015 2:101729146-101729168 ACAGGAAAAAAGGATAGGGAGGG - Intronic
935800534 2:106691023-106691045 CAAGGGAAGTAGGATAGGATGGG + Intergenic
936103539 2:109604364-109604386 AAAGGAAAGAAGGGAAGGGAAGG + Intronic
936154106 2:110037169-110037191 AAGGGGAAGAAGCAGAGGGAGGG - Intergenic
936190578 2:110334246-110334268 AAGGGGAAGAAGCAGAGGGAGGG + Intergenic
936502070 2:113074458-113074480 AAAGGGAAGAAGAGAAGGGAGGG - Intronic
936524417 2:113233088-113233110 AATGGGATGCGGGGTAGGGAGGG - Intronic
936977878 2:118237459-118237481 TTTGGGAAGCAGGACAGGGAAGG + Intergenic
937039201 2:118807893-118807915 AAAGGGAGGGAGGAGAGAGAAGG + Intergenic
937293588 2:120796614-120796636 AAAAGAAAGCAGGACAGAGAGGG - Intronic
937402849 2:121600091-121600113 AAAGGGAAGCAGGATCTAAAAGG + Intronic
937798153 2:126050131-126050153 AAAGGGAAGTAAGACAGGAAAGG - Intergenic
939187526 2:138878368-138878390 CTTGGGAAGCAGGACAGGGAAGG + Intergenic
939314418 2:140529417-140529439 AAAGGGAAGCTGAAAAGGGGGGG + Intronic
939419240 2:141944379-141944401 AAGAGGAATAAGGATAGGGAAGG - Intronic
939434655 2:142159524-142159546 GAAGGGAAGCAGGAGAGGAAGGG + Intergenic
939733851 2:145819319-145819341 AAAGGGAAGGAGGGGATGGAGGG - Intergenic
939799824 2:146695557-146695579 AAAGAGAAACAGGATAGGACAGG + Intergenic
939845715 2:147244040-147244062 AAAGCAAAGCAGGCTGGGGAGGG + Intergenic
940065664 2:149625162-149625184 AAAGGAATGGAGGTTAGGGAGGG + Intergenic
940087187 2:149873405-149873427 AAAGGGTAGCATGTAAGGGAGGG + Intergenic
940159280 2:150693855-150693877 AGAGGAAAGCAGGATGGGGAAGG + Intergenic
940402283 2:153261782-153261804 AAAGGGAGGCAAGAGTGGGAAGG - Intergenic
940852228 2:158699308-158699330 GAAGGGAAGCATGATTGTGATGG + Intergenic
940945697 2:159615620-159615642 AAAGGGCAGCAGGAGGCGGACGG + Intronic
941067231 2:160917252-160917274 AAAGTGAAACAGGATAAAGAAGG + Intergenic
941175711 2:162195332-162195354 AAAGGGAGGAAGAATAGGGCAGG + Intronic
941196870 2:162463347-162463369 AAAGGGAAGAAAGGGAGGGAAGG - Intronic
941733459 2:168945656-168945678 AAAGGGAAGGAAGGGAGGGAGGG + Intronic
941742282 2:169047468-169047490 AAAGGGAAGGAAGAAAGGGAAGG + Intergenic
941783590 2:169475435-169475457 AAAGGGAATAAGGAAATGGAAGG + Intergenic
942220340 2:173763019-173763041 AAAGGGAAGGAAGGAAGGGAGGG + Intergenic
942229646 2:173848422-173848444 AAAGGGGAGCAAGAGAGAGAGGG + Intergenic
942482322 2:176402884-176402906 AGAGGGAAGGAAGAAAGGGAAGG - Intergenic
942486096 2:176441469-176441491 AAAGAGAAGTAGAATAGAGATGG + Intergenic
942578345 2:177390233-177390255 ATAGGGAAGCATAAAAGGGAGGG + Intronic
942968366 2:181925718-181925740 GAAGGGAATCAGAATAGGAAGGG - Intronic
943055149 2:182968214-182968236 ATAGGGAAGCATGACTGGGAAGG + Intronic
943135876 2:183912532-183912554 AAAGAGAAGCAGGAGAAAGAAGG - Intergenic
943330415 2:186552099-186552121 TAGGGGAAGCAGGATAGGGTGGG + Intergenic
943332623 2:186577624-186577646 AAGGGAAAGGAGAATAGGGAAGG + Intergenic
943354811 2:186839878-186839900 AGGGGGAAGCAGCAAAGGGATGG - Intronic
943521668 2:188959423-188959445 AAAATAAAGCAGGATAGAGAAGG + Intergenic
943803997 2:192099133-192099155 AAAGGGAAGGAAAATAGGGAAGG - Intronic
944188693 2:196978266-196978288 AAGGGGGAGCAGGAGAGAGAGGG - Intronic
944647629 2:201795533-201795555 AAAAGGAAGGAAGAGAGGGAGGG - Intronic
944653831 2:201858347-201858369 AAAGGGAAGGAAGGAAGGGAGGG - Intronic
945057431 2:205881122-205881144 AAAGGGAAGGAAGAGAAGGAAGG + Intergenic
945773215 2:214071667-214071689 AAATTGAAGGAGGATAGGAAAGG - Intronic
945863011 2:215145148-215145170 AAAGAGAAGAAGGAAATGGAAGG - Intergenic
945936566 2:215908164-215908186 GAAGGAAAGGAGGATAGGAAAGG - Intergenic
946085041 2:217162433-217162455 AAAGGGAAGCAGGAGGATGAAGG + Intergenic
946142890 2:217706593-217706615 AAAGGGGAGGAGGAAGGGGAAGG + Intronic
946552961 2:220823422-220823444 AAAGGGAAGAAGGAAAAGGAAGG - Intergenic
946556914 2:220868954-220868976 AAAAGGCAGCAGGAGAGAGAAGG + Intergenic
946774639 2:223124869-223124891 TGAGGGAAGCAGGATTGGGCTGG + Intronic
947071028 2:226288032-226288054 GAAGGGAAGCAGGAGAGCGCAGG - Intergenic
947124161 2:226849932-226849954 ATAGGGAAGCAAGACAGGAATGG - Intronic
947224137 2:227823936-227823958 AAAGGGACAGAGGATGGGGATGG + Intergenic
948041578 2:234905657-234905679 AAAGGGAAGGAAGGAAGGGAGGG + Intergenic
948577764 2:238965376-238965398 AAAAGGAGGGAGGAGAGGGAGGG - Intergenic
948586107 2:239020764-239020786 AGAGGGAGGCAGGAGGGGGACGG - Intergenic
948933305 2:241146440-241146462 AAAGGGAGGGAAGAAAGGGAGGG + Intronic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1169447242 20:5682697-5682719 AAAGGGAAGGAAGGAAGGGAGGG - Intergenic
1169662972 20:8000653-8000675 GAAGGGAAGCAGGTCAAGGATGG - Intronic
1169673457 20:8130107-8130129 AAAGGAAAGGAGGAAAGGAAAGG + Intergenic
1169690114 20:8320994-8321016 AAAGGGAAGTAAAACAGGGAGGG + Intronic
1169710094 20:8551524-8551546 AAAGGGATGCAGGTATGGGATGG - Intronic
1169738390 20:8862903-8862925 GAAGTGAAGCAGGAAAGGGAGGG + Intronic
1169779411 20:9293235-9293257 GAAGGGAAGAAAGAAAGGGAAGG + Intronic
1169842819 20:9958861-9958883 AAAGGGAAGGAAGGAAGGGAGGG - Intergenic
1169920617 20:10730955-10730977 AAAGGGAGGAAGGAAGGGGAGGG - Intergenic
1170391058 20:15874942-15874964 AGAGGAAAGCAGAAGAGGGAAGG + Intronic
1170533420 20:17316475-17316497 AAAGGGAGACAGGGAAGGGAAGG - Intronic
1170803099 20:19606689-19606711 AGAGGGAAGAAGGCCAGGGAAGG + Intronic
1170957411 20:20993851-20993873 GGAGGGAAGAAGGATGGGGAGGG + Intergenic
1171142301 20:22753825-22753847 AGAGGGAAGGAGGATAAGCAGGG + Intergenic
1171295762 20:24015325-24015347 AAAGGGAATCAGGACAGGTTAGG - Intergenic
1171316397 20:24199508-24199530 GCAGAGAAACAGGATAGGGAAGG - Intergenic
1171724513 20:28603475-28603497 GATGGGAACCAGGATAGAGAAGG + Intergenic
1171788710 20:29498000-29498022 GATGGGAACCAGGATAGAGAAGG + Intergenic
1171858823 20:30376500-30376522 GATGGGAACCAGGATAGAGAAGG - Intergenic
1172125734 20:32624170-32624192 AAAGGTAAGTGGGAGAGGGAGGG - Intergenic
1172185239 20:33027408-33027430 AGAGGAAAGGAGGCTAGGGAAGG + Intergenic
1172735642 20:37125200-37125222 AAAGGGGAGGGGGAGAGGGAAGG - Intronic
1172785597 20:37466328-37466350 ATGGGGAAGCAGGACAGGAAAGG - Intergenic
1172808301 20:37629215-37629237 AGAGGGAAGCAGGAGAGGGAAGG + Intergenic
1172882026 20:38208309-38208331 AAAGGCAAGCAGAACAGGGAAGG - Intergenic
1172882119 20:38208876-38208898 AGAGGGAAGCAGGACTGGAAGGG + Intergenic
1172940289 20:38649380-38649402 AGAGTGAAGGAGGATAGGGAAGG + Intronic
1172943925 20:38673843-38673865 AGAGGGAATCAGGAAAGCGATGG + Intergenic
1173336135 20:42113685-42113707 AGTGGGAAGCAGGAGAGGGAAGG - Intronic
1173469398 20:43311093-43311115 AAAAGGAAGAAAGAGAGGGAGGG + Intergenic
1173537689 20:43828563-43828585 AAAGGGAAGGAGGCTGGAGAAGG + Intergenic
1173588265 20:44201855-44201877 AAAGGAAAGGAGGAGAGGTAAGG + Intronic
1173624824 20:44465085-44465107 GAAGGGAAGCAAGACAGGGAGGG + Intronic
1173755081 20:45508666-45508688 GAAGGGAAGGAGGGAAGGGAAGG - Intergenic
1173876674 20:46376642-46376664 GAAGGGAAGCAGGATATTGTGGG - Intronic
1174047500 20:47743977-47743999 AAAGGCAAGAAGGAAGGGGAGGG - Intronic
1174327366 20:49790025-49790047 GGAGGGAAGTAGGACAGGGAAGG - Intergenic
1174334993 20:49853623-49853645 AAAGGGAAGGAAGAAAGGGAAGG - Intronic
1174346284 20:49932542-49932564 AAAGGAAAGAAAGAAAGGGAGGG + Intergenic
1174696944 20:52569321-52569343 AAAGGAAAGGAGGGAAGGGAAGG - Intergenic
1174769106 20:53281729-53281751 GTAGGGAAGCAGGACAGGGAAGG + Intronic
1175046979 20:56116218-56116240 GAAGGGAGGCAGGGGAGGGAGGG + Intergenic
1175279079 20:57790736-57790758 AGAGGGAGACAGGATGGGGAGGG + Intergenic
1175425504 20:58862848-58862870 AAGGGGGAGCTGGATAGGCAGGG - Intronic
1175499882 20:59442163-59442185 AAAGGGAAGGAGGAACGGGGTGG - Intergenic
1175666373 20:60863710-60863732 AAATGGAAGGAAGAAAGGGAAGG + Intergenic
1175691028 20:61066130-61066152 AAAGGGAAGCTGTAGAGGGCAGG + Intergenic
1176819731 21:13644901-13644923 AGAGGCAAGCAGACTAGGGAGGG + Intergenic
1176957626 21:15124330-15124352 ACAGGGAAGAAGGAGGGGGAAGG + Intergenic
1177497138 21:21903815-21903837 GAAGGGAAGGAGGGAAGGGAGGG + Intergenic
1177610579 21:23442496-23442518 AATGGGAAGTAGCAGAGGGAAGG + Intergenic
1177730229 21:25019833-25019855 ATAGGGAAGCATTAAAGGGATGG + Intergenic
1178685347 21:34706319-34706341 AAAGGGCAGCAGCAAGGGGATGG + Intronic
1178691679 21:34755116-34755138 AAAAGGAAGAAGGATAGGAAAGG + Intergenic
1179217123 21:39377228-39377250 AGAGGGAAGCAGGAGAGCCAGGG + Intergenic
1179422223 21:41245735-41245757 AAATGGACCCAGGAAAGGGAGGG - Intronic
1179473235 21:41626025-41626047 AGAGGGAAGGAGGATGGGCAGGG + Intergenic
1179603323 21:42495879-42495901 AATGGGAGGCAGGATGGGGGTGG + Intronic
1179952469 21:44716940-44716962 AAAGGGAAGCAGGCCAGGCGTGG - Intergenic
1180298065 22:10962172-10962194 GATGGGAACCAGGATAGAGAAGG + Intergenic
1180410348 22:12601626-12601648 GATGGGAACCAGGATAGAGAAGG - Intergenic
1180542145 22:16459137-16459159 GAAGGGAAGAAGGGAAGGGAAGG + Intergenic
1180911477 22:19453891-19453913 AAAAGGAACCAGGAGAGCGATGG + Intronic
1181119524 22:20656701-20656723 AAAAGGAAGCAGGGTAGGTGTGG - Intergenic
1181286928 22:21759104-21759126 AAAGAGAAGCAGTGCAGGGATGG - Exonic
1181428821 22:22864278-22864300 AAAGGAAAGGAAGAGAGGGAAGG + Intronic
1181735822 22:24880710-24880732 AAATGGAAGCAGGAAGGGGTGGG + Intronic
1181738366 22:24899809-24899831 AAAGAGAAGCAAGCTAGGCATGG - Intronic
1181844730 22:25698085-25698107 GAAGGGAGGAAGGAGAGGGAGGG + Intronic
1182307726 22:29382598-29382620 GGAGGGAAGGAGGATAGGGAGGG + Intronic
1182677786 22:32053367-32053389 AAAGAGAAGGAAGAAAGGGAAGG - Intronic
1182713487 22:32336986-32337008 AAAGAAAAGCAGGACAGGGCTGG + Intergenic
1182936393 22:34226441-34226463 CAAGGTAAGAAGGATGGGGAAGG + Intergenic
1183249996 22:36723655-36723677 TAAGGAAAGCAGGAAATGGAGGG - Intergenic
1183339871 22:37274199-37274221 AAGGGGGAGCAGCAGAGGGATGG - Intergenic
1183352673 22:37342815-37342837 AAAGGGAAGCGGGGAGGGGAGGG + Intergenic
1183729162 22:39607581-39607603 AAGGGGAAGAGAGATAGGGAGGG + Intronic
1183743884 22:39682465-39682487 AAAGGGAGGTAGGATGGGGCAGG - Intronic
1183759448 22:39802653-39802675 AAAGGGAAACAGGAGAAAGAAGG + Intronic
1184052511 22:42018367-42018389 GAAGGGAAGAAGGAAATGGAAGG + Intronic
1184133465 22:42531899-42531921 CAAGGGGAGCAGGGTAAGGAGGG - Intergenic
1184369247 22:44072194-44072216 AAAGGGGGACAGGGTAGGGAGGG - Intronic
1184437553 22:44488788-44488810 AAAGGAAAGGAGGAAAGGGGAGG + Intergenic
1184899014 22:47432663-47432685 AAAGAGAAGAAGGAAAAGGAAGG + Intergenic
1184946978 22:47810774-47810796 AAAGGGAAGCAGGAGGGCCAAGG - Intergenic
1184959311 22:47917713-47917735 AAAGGGAGGAAGGAGAGGGAGGG - Intergenic
1184988983 22:48154756-48154778 AAAGGGAAGCAAGTTGGGGCTGG + Intergenic
1185006743 22:48282496-48282518 AAATAGAAGCAGGCTAGGCATGG + Intergenic
1185061867 22:48611296-48611318 AAAGGGGAGCAGGTGAAGGAAGG - Intronic
1185135772 22:49071261-49071283 AAAGGAAGGAAGGAAAGGGAAGG - Intergenic
1185148012 22:49149773-49149795 GAAGGGAAGGAGGCTGGGGAGGG + Intergenic
1185330517 22:50250188-50250210 AAAGGGCAGCAGGGAAGGCAGGG - Intronic
1185414311 22:50701354-50701376 AAAGGGAAGGAGGGAGGGGAGGG - Intergenic
949405060 3:3705454-3705476 AAAGGGAGGAAGGAGAGGGAGGG + Intronic
949491548 3:4594330-4594352 TAAAGGAAGCAAGACAGGGAAGG - Intronic
949493564 3:4611053-4611075 AAAGGGAAGGAAGGAAGGGAGGG - Intronic
949654656 3:6203819-6203841 AAAGCTAAGCAGGACAGAGAGGG + Intergenic
949708190 3:6842841-6842863 GAAGGGGAGCTGGAGAGGGAAGG - Intronic
949787702 3:7759797-7759819 AAAGGGAAGCAGGGGAGAGAGGG + Intergenic
949810404 3:8001116-8001138 AAAGGGCAGAGTGATAGGGAGGG - Intergenic
949916094 3:8965792-8965814 AAAGGAAGGAAGGAAAGGGAGGG - Intergenic
950191408 3:10978975-10978997 AAAGGATAGAAGGAAAGGGAAGG + Intergenic
950383590 3:12638031-12638053 AAAGAGAAGAATGATGGGGAAGG - Intronic
950671299 3:14527398-14527420 AAAGGAAAGAAGGAAAGCGAGGG + Intronic
950684720 3:14608315-14608337 CAAGGGAAGCAGGACAGGAGAGG - Intergenic
950753906 3:15156057-15156079 GAAGGGAAGGAGGAAAGGGAAGG + Intergenic
950878323 3:16299220-16299242 ACAGGCAAGCAAGAGAGGGAGGG + Intronic
951144844 3:19214619-19214641 TAAGGGAAGCAGGATTGAGAAGG - Intronic
951473366 3:23079604-23079626 TAAGGGAAGCCTGATATGGAGGG - Intergenic
951524404 3:23640031-23640053 CAAGGGAGGCAAGATAGAGAAGG + Intergenic
951534678 3:23729874-23729896 AAAAGGAAGCAGGAGTGGGCAGG - Intergenic
951719976 3:25688116-25688138 AAAGAAAAGAAGGAAAGGGAAGG + Intergenic
951752519 3:26053518-26053540 GAAGGGAGGCAGGAAAGGGAAGG + Intergenic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
951839929 3:27023440-27023462 TAAGAGAAGCAGGATAGGGCAGG + Intergenic
952059588 3:29491613-29491635 AAAAGGAAGGAAGAGAGGGAAGG + Intronic
952369245 3:32703793-32703815 AAAGTGAAACTGGATAAGGAGGG + Intronic
952404360 3:32992346-32992368 AAAGGGATGCAGGGAAAGGATGG + Intergenic
952425995 3:33174867-33174889 AAAGGTAAGCAGCCCAGGGATGG - Exonic
952478599 3:33736475-33736497 TGAAGGAAGCAGGATAGGAAAGG - Intergenic
952537845 3:34332728-34332750 GAAGGAAAGAAGGAAAGGGAAGG - Intergenic
952758132 3:36890281-36890303 CAAGGGAGGCAGGACAGGTAGGG + Intronic
952759798 3:36903777-36903799 AAAGCGCAGCAGGGCAGGGATGG + Intronic
953010003 3:39016075-39016097 TGAGAGAAGCAGGGTAGGGAAGG + Intergenic
953038931 3:39237786-39237808 GGAGGGAAGCAGGATGGGGCAGG - Intergenic
953205337 3:40822772-40822794 TAAGGGAAGCAGGGCAGGGGAGG - Intergenic
953481370 3:43255185-43255207 AACGGGAAGCAGGCTGGGGCAGG - Intergenic
953576385 3:44116186-44116208 AAAAGGGAGGAGGGTAGGGAAGG - Intergenic
953675313 3:44996802-44996824 AAAGAGAAACAGGAGAGTGATGG - Intronic
953701251 3:45197758-45197780 AAAGAGAAGCTGGGTTGGGATGG - Intergenic
953797035 3:45993902-45993924 AAAGGGAAGCAGGGTGGGTGGGG + Intronic
954315197 3:49797458-49797480 GAAGGAAAGAAGGAAAGGGAAGG - Intronic
954731948 3:52671406-52671428 AAAAGGAGGCAGCAGAGGGACGG + Intronic
955150698 3:56363901-56363923 GAAGGGAAGGAGGGTAGGAAGGG + Intronic
955163022 3:56483817-56483839 AAAGGGAGGGAGGGAAGGGAAGG + Intergenic
955364813 3:58301895-58301917 GGAGGGAAGCAAGATAGGGCAGG - Intergenic
955672134 3:61412740-61412762 GAAGGGAAGAAGGAAAGGGAAGG + Intergenic
955858540 3:63300806-63300828 AGAGGGAAGAAGGATAGAGCAGG - Intronic
956098704 3:65745228-65745250 AAACAGAAGCAGGAAAGAGAAGG + Intronic
956159623 3:66335591-66335613 AAAGGGATGAAGAAAAGGGAGGG - Intronic
956208991 3:66783793-66783815 AAAAGGAAAGAGGATATGGAGGG - Intergenic
956310835 3:67877814-67877836 AAAGAGAAGGAGGAGAGGGAGGG - Intergenic
956373447 3:68588818-68588840 AAAGGGAAGTTAGAAAGGGAAGG + Intergenic
956518690 3:70080066-70080088 AAAGTGAAGCCAGATAGAGAAGG - Intergenic
956530433 3:70211867-70211889 GAAGGGAAGAAGGGAAGGGAAGG - Intergenic
956778717 3:72587721-72587743 AGAGGGAAGCAGGACTGGGAGGG + Intergenic
956913985 3:73851474-73851496 GAGGGGAAGTATGATAGGGAAGG + Intergenic
957073886 3:75586189-75586211 AAAGGAAATCAGGAGAGGAAAGG + Intergenic
957181048 3:76877879-76877901 AAAGGGCAGGAGGAAAGGAAAGG + Intronic
957383635 3:79467490-79467512 GAAGGGAGGCATGATAGAGAAGG + Intronic
957685356 3:83498551-83498573 AAAGGGAAGCAGCATGGATATGG + Intergenic
957794177 3:84981611-84981633 AAAGGAAAGAAAGATAGGGAAGG - Intronic
957831189 3:85522193-85522215 AAAGGGAAGGCGAACAGGGAAGG - Intronic
957887378 3:86305355-86305377 AAATGGAAGAAGGAAGGGGAGGG - Intergenic
958078416 3:88713116-88713138 AAAGGGAGGGAGGAGTGGGAAGG + Intergenic
958734564 3:97993745-97993767 AAAGGGAAGAGGGGGAGGGAAGG - Intronic
958867584 3:99519069-99519091 ACAGGAAAGCAGGATGGAGAGGG - Intergenic
958967916 3:100579647-100579669 GAAAGGAAGCAAGAGAGGGAAGG - Intergenic
959326372 3:104942027-104942049 AAAGGGCAGCAGGAAATGAAAGG + Intergenic
959693196 3:109221378-109221400 CAAAGGAAGCAGGATCAGGAGGG - Intergenic
960156874 3:114305450-114305472 TGAAGGAAGCAGTATAGGGAGGG + Intronic
960455059 3:117860764-117860786 TAAGGGATGAAGGATAGGGAAGG - Intergenic
960486277 3:118256689-118256711 AGAAGAAAGCAGGATAGGAAAGG + Intergenic
960513477 3:118577643-118577665 AAAGGGTTGAAGGGTAGGGAGGG + Intergenic
960748528 3:120918156-120918178 AAAGGGAGGCAGGAAAGTCAGGG - Intronic
960924693 3:122782802-122782824 AAAAGGAAGAGGGATAGGGAAGG + Intronic
960959553 3:123060326-123060348 GAAGGAAAGAAGGAAAGGGAAGG - Intergenic
961175228 3:124829939-124829961 AAGGGGAAGCAGGAATGAGATGG + Intronic
962064007 3:131960123-131960145 AGAGGGAGGGAGGAGAGGGAGGG + Intronic
962204785 3:133425795-133425817 GAAGGGAAGAAGGGAAGGGAAGG + Intronic
962330850 3:134476561-134476583 TAAGGTAAACAGGATAGGGCAGG - Intergenic
962849952 3:139300975-139300997 AAAGTGAACCAGGTTGGGGAGGG + Intronic
963025698 3:140916800-140916822 AAAGTGAAGAGGGAAAGGGAGGG - Intergenic
963592561 3:147280818-147280840 AAAGGAAGGAAGGAAAGGGAAGG + Intergenic
963649882 3:147965710-147965732 TAAAGGAAGCAGAATAAGGATGG - Intergenic
963919514 3:150892316-150892338 TGAGGGAAGCAGGACAGGGAAGG - Intronic
965054078 3:163692014-163692036 AAAGGGAAGAAAGGAAGGGAGGG - Intergenic
965164994 3:165186648-165186670 AAATGGAAGCACGAAAGGCATGG + Intergenic
965202750 3:165680987-165681009 AAAGGGGAACAGGAGTGGGAAGG - Intergenic
965491985 3:169349056-169349078 AAAGGGGAGGATGAGAGGGAGGG - Intronic
965545583 3:169912880-169912902 GAAGGGGAGCAAGATATGGAGGG + Intronic
965594860 3:170400568-170400590 GAAGGGAAGGAGGAGAGGGAGGG - Intergenic
965631112 3:170733984-170734006 AAAAGAAAGCAGGATAGGGAAGG + Intronic
965744357 3:171908430-171908452 AAAGGGAAACTGGATAAGGAGGG - Intronic
965954529 3:174352418-174352440 AAAGGAAAGGAGGAAAGGAAAGG + Intergenic
966569393 3:181424046-181424068 AAAGGAAAGAAGGAAAGGAAAGG + Intergenic
966608364 3:181844264-181844286 AAAAGGCAGCAGGCTAGGCAGGG + Intergenic
966936487 3:184712966-184712988 GAAGGGAAGGAGGGAAGGGAGGG - Intergenic
967132618 3:186486503-186486525 AAAGGAAAGAAGGAAAAGGAAGG + Intergenic
967218864 3:187232510-187232532 AAAGGGGAGAAGGTTAGTGAAGG - Intronic
968073083 3:195799949-195799971 AAAGAGCAGCAGGTGAGGGATGG - Intronic
968366884 3:198192391-198192413 AAAGGGAAGGAGGGAAGGAAAGG - Intergenic
968689704 4:1984202-1984224 AGAGGGTAGCAGGACAGAGAAGG - Intronic
968857496 4:3138119-3138141 AGAGGGAAGTAGGGAAGGGAGGG - Intronic
969345934 4:6570020-6570042 AAAGGGAGGGAGGGAAGGGAAGG + Intergenic
969352877 4:6608299-6608321 AAAGGGAGGCAGGCTGTGGAGGG - Intronic
969510222 4:7613418-7613440 CAAGGGAAGCAGGGTAGGCCTGG + Intronic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
969629240 4:8325927-8325949 AAAGGGGATCAGGCTGGGGAAGG - Intergenic
969885243 4:10209440-10209462 GAAGGGAGACAGGATGGGGAAGG + Intergenic
969951486 4:10841162-10841184 TGGGAGAAGCAGGATAGGGAAGG + Intergenic
970107832 4:12605009-12605031 ATAGGGAAGCAGGAGAAGGAAGG - Intergenic
970132918 4:12890954-12890976 GAAGAGCAGCAGGGTAGGGAAGG + Intergenic
970297014 4:14641292-14641314 AAAGGAAAGAAGGGAAGGGAAGG + Intergenic
970468922 4:16356516-16356538 TGAAGGAAGCAGAATAGGGAGGG + Intergenic
970818598 4:20187534-20187556 AAAGGAAAGCAAAACAGGGAAGG + Intergenic
970889561 4:21027443-21027465 AAAGGGAGGCAGGAGAGTCAGGG + Intronic
970929538 4:21493401-21493423 GATGGGGAGCAGGATAGAGAGGG - Intronic
971251325 4:24975512-24975534 AAGGAAAAGTAGGATAGGGAAGG + Intronic
971394419 4:26215153-26215175 GGAGAGAAGGAGGATAGGGAAGG + Intronic
971445917 4:26748769-26748791 AAAGGGGAGAGGGAAAGGGAAGG - Intronic
971480900 4:27114298-27114320 AAAAGGAAGCAGAAAAGAGAAGG - Intergenic
972104096 4:35461343-35461365 AAAGGGAAGGAAGAATGGGAAGG - Intergenic
972109009 4:35531604-35531626 TGAAGGAAGAAGGATAGGGAGGG + Intergenic
972302425 4:37797507-37797529 GAAGGGTAGCAGGAGAGGAAGGG + Intergenic
973151147 4:46889515-46889537 ACGGGGAAGCAAGATAGGCAAGG + Intronic
973620848 4:52723687-52723709 AAAGGGAAGGAAGAAAGGGAGGG + Intronic
974994347 4:69134829-69134851 TAAGGCAGGCATGATAGGGAAGG + Intronic
975618870 4:76275797-76275819 AAAGGGGAGAAGGAGAGGAATGG - Intronic
975886767 4:78975665-78975687 AAAGGGAAGGAAGGAAGGGAGGG - Intergenic
975916654 4:79333230-79333252 TCAGGGATGCAGGATAGGAAAGG + Intergenic
976135050 4:81926673-81926695 AAACGGTAGCAGGGTGGGGAGGG - Intronic
976266164 4:83186986-83187008 AGAGGGGAGAAGGAGAGGGAGGG + Intergenic
976482673 4:85563035-85563057 TGAGGGAAGCAGGATGGGGCAGG + Intronic
976825501 4:89256140-89256162 ATAAGGAAGCAGCATAGGAAGGG - Intronic
977242648 4:94591740-94591762 AAAAGGAAGCAGGAGTGGGTAGG - Intronic
977820197 4:101462384-101462406 AAAGGGAAGGATGATGGGGAGGG + Intronic
977947612 4:102931333-102931355 GAAGGGAAGAAGGGAAGGGAAGG + Intronic
978243768 4:106548749-106548771 GAAGGGAAGGAAGAGAGGGAGGG - Intergenic
978346739 4:107777941-107777963 AAAGAGAAGGAGGAAAGGCAGGG + Intergenic
978555345 4:109973600-109973622 AAAGGGAAGGAGGAGAGGTCGGG - Intronic
978952548 4:114578546-114578568 GAAGGGAAGCTGAATAGGAAGGG - Intergenic
979016126 4:115436164-115436186 AAAGGGAGGCAGGAAATGCAGGG - Intergenic
979255297 4:118602000-118602022 AAAGGGAAGGAGGGAAGGAAAGG - Intergenic
979323638 4:119353303-119353325 ATAGGGAAGGAGGAAAGAGAAGG - Intergenic
979602782 4:122604504-122604526 TGAGAAAAGCAGGATAGGGAAGG - Intergenic
979788623 4:124750019-124750041 GGAGGGAATCAGGAAAGGGAAGG + Intergenic
980505103 4:133709102-133709124 GAAGGGAAGAAAGAAAGGGAAGG - Intergenic
981676706 4:147350922-147350944 GAAGGGAAGGAGGGAAGGGAAGG + Intergenic
981887281 4:149691495-149691517 AAAGTGAAGGAGGAAAAGGATGG + Intergenic
982804743 4:159749271-159749293 AAAGGAAAGGAGGGAAGGGAAGG - Intergenic
983241470 4:165237969-165237991 ATAGGGAAGGAGGAAAGAGAAGG - Intronic
983622573 4:169775618-169775640 AAAGGGAAGGAAAAAAGGGAGGG - Intergenic
983919718 4:173333480-173333502 AAGGTGAGGCAGGAGAGGGACGG - Exonic
983939452 4:173525060-173525082 AACTGGAATCAGGAGAGGGAGGG + Intronic
984086224 4:175314810-175314832 AAAGGCAAGGAGGTTAGGGAGGG + Intergenic
984249640 4:177316577-177316599 AGAGTCAAGCAGGATGGGGATGG + Intronic
984612408 4:181856173-181856195 AAAGGGAAGGAAGGGAGGGAGGG + Intergenic
984635046 4:182101338-182101360 AAAAGGAAGGAAGAAAGGGAGGG + Intergenic
984648748 4:182246749-182246771 AAAGCGAAGGACGAGAGGGAGGG - Intronic
984858958 4:184219919-184219941 AAAGCGAAGAAGGGAAGGGAAGG + Intronic
984859000 4:184220061-184220083 AAAGCGAAGAAGGGAAGGGAAGG + Intronic
985054779 4:186026704-186026726 AAAGGGAAGGAAGGAAGGGAGGG - Intergenic
985436965 4:189940169-189940191 TGAGGGAACCAGGATAGAGAAGG - Intergenic
985851597 5:2392501-2392523 AAAGGGAAAGAAGAGAGGGAGGG - Intergenic
986142421 5:5043438-5043460 GAAGGGAAGGAGGGAAGGGAGGG + Intergenic
986142433 5:5043474-5043496 AAAGGGAAGGAGGGAAGGGTAGG + Intergenic
986156049 5:5177019-5177041 AAGGAGAAGCAGGACTGGGAAGG - Intronic
986723442 5:10577069-10577091 AAAGGGAAAGGGGAAAGGGAAGG - Intronic
986969527 5:13315920-13315942 AAAGGGGGGGAGGGTAGGGATGG - Intergenic
987073242 5:14357889-14357911 AAAGAGAAAAAGGAAAGGGAAGG - Intronic
987109045 5:14667712-14667734 AAAAGGAAGGAAGAGAGGGAGGG - Intronic
987334831 5:16889444-16889466 AAAGGAAAGAAGGAAGGGGAAGG + Intronic
987371881 5:17201031-17201053 AAAATGAAGCAGGGTAAGGATGG + Intronic
987518601 5:18948261-18948283 AAAGAGAAGAAGGAGAAGGAAGG + Intergenic
987738836 5:21878938-21878960 AAAGGAAAGAAAGAGAGGGAGGG + Intronic
987784076 5:22476541-22476563 GAAGGGTAGCAGGATTGTGAGGG - Intronic
987813888 5:22875536-22875558 AGAGGGAAGGGGGATAAGGAAGG - Intergenic
987920158 5:24269769-24269791 GAAGGGAAGCAAGCTAGGTAAGG - Intergenic
988322466 5:29716567-29716589 CAGAGGAAGCAGGATAGGAAAGG - Intergenic
988485573 5:31665650-31665672 ACAAGGCAGCAGGAAAGGGAGGG - Intronic
989188462 5:38646854-38646876 TGAGGGAAGCAGGATTGGAAAGG + Intergenic
989423785 5:41272069-41272091 AAAAGGAAGGAAGAAAGGGAGGG - Intergenic
989505646 5:42224210-42224232 TGAGGGAAGCAGGATAGTAAAGG - Intergenic
989622548 5:43398935-43398957 AAAGAGCAGTAGGTTAGGGATGG - Intronic
990147332 5:52776660-52776682 AAAGGGAAGGAAGAGAGGAAAGG + Intergenic
990346173 5:54873877-54873899 TGAGGGAAGCAGGATAGGGCAGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990584751 5:57200155-57200177 AAAGAGAGGAAGGAAAGGGAAGG - Intronic
990918110 5:60932871-60932893 AAAGGGAAAGAGAAGAGGGAAGG + Intronic
990942106 5:61213174-61213196 TGAGAGAAGCAGGATAGGGAAGG + Intergenic
990958110 5:61363984-61364006 AAAAGAAAGAAGGAAAGGGAGGG - Intronic
991030231 5:62074842-62074864 AAAGGGAGGGGGGATAAGGAGGG + Intergenic
991084929 5:62639985-62640007 AGAGGGTAGGAGGAGAGGGATGG - Intergenic
991090435 5:62689230-62689252 AAAGGGAAACAGGCTGGGCATGG + Intergenic
991355941 5:65768713-65768735 AAAGGCCAGCAGGGAAGGGAAGG - Intronic
991440262 5:66640094-66640116 AAAAGGAAGCAGAATAGAGGTGG - Intronic
991556185 5:67897111-67897133 GAAGTGAGGCAGGAAAGGGAAGG + Intergenic
991631181 5:68657649-68657671 ACAGTGAAGCAGGATTTGGATGG - Intergenic
991971818 5:72148682-72148704 AAAAGGAAACAGGAACGGGAAGG + Intronic
991982526 5:72247849-72247871 AAAGGGGAGTAGGATAGGGTGGG + Intronic
992185865 5:74243527-74243549 AAAGGGAAGGAAAAGAGGGAGGG + Intergenic
992339144 5:75804731-75804753 GAAGGGTATCAGGACAGGGAGGG - Intergenic
993038346 5:82783489-82783511 GTGGGGAAGCAGGATAGGAAAGG + Intergenic
993164770 5:84338485-84338507 AAAAGGAAGGAAGAGAGGGAGGG - Intronic
993330155 5:86589608-86589630 GGAGGCAAGCAGGACAGGGAAGG - Intergenic
993826015 5:92687826-92687848 GCAGAGGAGCAGGATAGGGAGGG - Intergenic
993830278 5:92748319-92748341 AAAGGAAAGAAGGAAAGGAAAGG - Intergenic
993982962 5:94564928-94564950 AAAGGGAGGGAGGGAAGGGAAGG - Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994930466 5:106176480-106176502 AAAGAGAAGCAAGATTGGCACGG - Intergenic
995348854 5:111152090-111152112 AAAGGGAAGAAGGAAAGAAAGGG - Intergenic
995455600 5:112348569-112348591 ATAGGGAAGCAGGTGGGGGAGGG + Intronic
995482983 5:112611162-112611184 CGAGGGAAACAGGATAGGGAAGG + Intergenic
995629601 5:114118890-114118912 AGATGGAGGCAGGATAGGGGAGG + Intergenic
995664259 5:114523365-114523387 AAAGGGAAGCAAGTGAGGCAGGG + Intergenic
995908280 5:117153455-117153477 GAAGGGAAGGAAGAGAGGGAAGG - Intergenic
995926549 5:117381837-117381859 ATAGAGAGGCAGGAGAGGGAGGG - Intergenic
996209077 5:120782536-120782558 AGAGGGAAGCAGCATATGGGAGG - Intergenic
996598533 5:125233313-125233335 AAAAGAAAACAGGAAAGGGAGGG + Intergenic
996765948 5:127034115-127034137 GAAGGGAGGGAGGAAAGGGAAGG - Intergenic
997121397 5:131176717-131176739 AAAAGGGAGGAGGATAGGAAGGG - Intronic
997197075 5:131987458-131987480 ATAGGGAGGCAGGAGAAGGAGGG + Intronic
997222736 5:132182470-132182492 AAAGGGAAGGAAGGGAGGGAGGG + Intergenic
997566972 5:134895458-134895480 AGAAGAAAGCAGGTTAGGGAGGG - Intronic
997961982 5:138329475-138329497 ACAGGGAAGGAGGATAGAGACGG - Intronic
998073423 5:139217041-139217063 AAAGAGAAGAAGGGTAGTGAAGG + Intronic
998136469 5:139676850-139676872 AAAGGGGAGCTGGAGAGGAAGGG - Intronic
998450599 5:142231726-142231748 AGAGGGCAGAAGGAAAGGGAGGG - Intergenic
999015308 5:148097042-148097064 AAAGGAAAGGAAGAAAGGGAAGG - Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999666982 5:153922821-153922843 AGAGGGAAGCAGGAGAGGCTGGG - Intergenic
1000018349 5:157298102-157298124 AAAGGAAAGCAGGGAAGGAAGGG - Intronic
1000096240 5:157973354-157973376 AAAGGGAAGAAGGGAAGGAAGGG - Intergenic
1000185058 5:158851356-158851378 AAAGGGAAGAAGGAAAGGGAAGG + Intronic
1000185207 5:158851794-158851816 AAAGGGAAGGAGGGAAGGGAAGG + Intronic
1000217766 5:159180096-159180118 GTAGGGAAGAAGGAGAGGGAGGG + Intronic
1000349737 5:160343941-160343963 CAAGGGAAGCTGGATGGAGAGGG - Intronic
1000427146 5:161104803-161104825 AAAAGGAAGAAGGAAAGAGAGGG - Intergenic
1000538000 5:162503812-162503834 GAAAGAAAGCAGGTTAGGGATGG - Intergenic
1000663713 5:163968790-163968812 ACAGGGAAACAGGAAAAGGAAGG - Intergenic
1000867764 5:166536688-166536710 AAAAGGAAGGAGGTAAGGGAAGG + Intergenic
1000872000 5:166588531-166588553 AAAGGGAAGGAGGAGAGAGAAGG - Intergenic
1000882452 5:166713917-166713939 AAGAGGAAGCAGGAAAGAGAGGG + Intergenic
1000892901 5:166820043-166820065 AGAGAGAAGAATGATAGGGAAGG - Intergenic
1001196503 5:169677876-169677898 AAAGGGAAGCTGGATGTGGGAGG + Intronic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001663400 5:173413196-173413218 AATGGGAAGCAGCACAGGGCAGG + Intergenic
1001755464 5:174165239-174165261 GAAGAGAAGCAGGGGAGGGAAGG - Intronic
1001803079 5:174560107-174560129 CAGTGGAAGCAGGATAGGGCAGG - Intergenic
1001853056 5:174986114-174986136 GCAGGGAAGGAGGATAGGGAGGG - Intergenic
1001977908 5:176015454-176015476 AGAGGGAGGAAGGATAGGGAAGG - Intronic
1002189399 5:177470866-177470888 ACAGGGAATCAGGATGGGGTAGG + Intronic
1002239512 5:177828308-177828330 AGAGGGAGGAAGGATAGGGAAGG + Intergenic
1002255417 5:177954744-177954766 AAAGGGAAAGAAGAAAGGGAGGG + Intergenic
1002414984 5:179115645-179115667 AAAGGAAAAAAGGAAAGGGAGGG + Intronic
1002482629 5:179513322-179513344 AAAGGGAAGGAAGAAAGGGAGGG - Intergenic
1002613476 5:180436226-180436248 GAAGGGAGGCAGGGAAGGGAGGG + Intergenic
1002726107 5:181297589-181297611 AAAGGGAAGGAGGGAAGGAAAGG - Intergenic
1002893206 6:1355794-1355816 AAAGGAAAGGAAGAGAGGGAAGG + Intergenic
1003243494 6:4365022-4365044 TGAGGGATGCAGGATAGAGAAGG + Intergenic
1003548230 6:7079116-7079138 AAAGGGAAGGAAGTGAGGGAGGG + Intergenic
1003607580 6:7577921-7577943 AAAGGGAAGAAGCAGAAGGAGGG - Intronic
1003612132 6:7623128-7623150 AATGAGTAGCAGGATAGTGAGGG - Intergenic
1004131200 6:12921617-12921639 AAAGGGAGGAAGGAGAGGGAGGG + Intronic
1004313014 6:14562512-14562534 ACAGGGAAGCAGAATTGGGCAGG - Intergenic
1004383062 6:15149033-15149055 AAAGGGACGAAGCCTAGGGAAGG - Intergenic
1004521260 6:16363054-16363076 AAAAGTAGGCAGGGTAGGGATGG - Intronic
1004748663 6:18538563-18538585 AAAGGGAGGGAGGGAAGGGAGGG - Intergenic
1004761121 6:18667662-18667684 AAAAGGAAGGAAGGTAGGGAGGG - Intergenic
1004920374 6:20370337-20370359 CAAGGGAGGCAGGATAGAGATGG - Intergenic
1005148348 6:22718769-22718791 AAAGGGAGGCAGAATAAGAATGG + Intergenic
1005413249 6:25573141-25573163 CAAGGGGAGGAGGATGGGGAGGG + Intronic
1005513946 6:26537063-26537085 ACAGGGAAAGAGGATAGGAAAGG - Intergenic
1005770921 6:29070185-29070207 AAAGGGTAGGAGGGGAGGGAGGG + Intronic
1005880577 6:30056226-30056248 AAAAGGAGGAAGGTTAGGGAAGG - Intergenic
1005944468 6:30585396-30585418 AAAGGAAAACAGGGCAGGGAGGG - Intronic
1005948975 6:30617147-30617169 TCTGGGAAGCGGGATAGGGATGG - Intronic
1006146622 6:31963379-31963401 AGAGGGAAGCAGGTCAGGGGTGG - Intronic
1006298969 6:33183410-33183432 AAAGGGAATCATGACAGTGAAGG + Intronic
1006513267 6:34532937-34532959 GAAGGGAAGCAGGGCAGGGGAGG - Exonic
1006564421 6:34942834-34942856 AAAGAAAAGAAGGATGGGGAGGG - Intronic
1006731875 6:36242375-36242397 AAAGGGAAGGAAGGAAGGGAAGG - Intergenic
1006827785 6:36948769-36948791 AAAGGAAAGAAAGAAAGGGAAGG - Intronic
1007054806 6:38872005-38872027 AGAGGAAAGCAGGACAGGAATGG - Intronic
1007310356 6:40940520-40940542 AAAGGCAAGCAGGGTGGGGGAGG + Intergenic
1007310914 6:40945478-40945500 AAAAGGGAGCAGGAAAGAGAGGG + Intergenic
1007321867 6:41033484-41033506 AAAGAGAAGAAGGACAGAGATGG + Intronic
1007384037 6:41508652-41508674 AAGGGGAAGTGAGATAGGGATGG - Intergenic
1007509490 6:42364328-42364350 ACAGGGAAGGAGGCTAGGAAGGG - Intronic
1007945408 6:45822341-45822363 AAAGGGAATCAGGAAACAGATGG + Intergenic
1008057471 6:46959891-46959913 AAAGGGAAGGAAGAGAGGAAGGG + Intergenic
1008838695 6:55870078-55870100 AAATGGAAGAATGAAAGGGAAGG + Intronic
1009650998 6:66478469-66478491 ATAGAGAAGCAGGACTGGGAAGG - Intergenic
1009856761 6:69274642-69274664 AAAGGGAAGAAGGGAAGAGAAGG - Intronic
1009885445 6:69618697-69618719 AAAGGAAAGCAGGAAGGAGAAGG + Intergenic
1010029701 6:71260108-71260130 AAGGGTAAGCAGGATAGGGCAGG - Intergenic
1010159617 6:72837654-72837676 AAAAGGAAGCAGTATAGCAATGG - Intronic
1010265578 6:73862245-73862267 AAGGAGAAGCAGGAAAGGTAGGG - Intergenic
1010635577 6:78255818-78255840 TGAGGGAAGCAGGAAAAGGAAGG - Intergenic
1010848209 6:80738451-80738473 AAAGGAAGGAAGGAAAGGGAAGG - Intergenic
1011017774 6:82777680-82777702 AGAGGGAAGGAGGGGAGGGAGGG + Intergenic
1011137602 6:84116952-84116974 AAAGGGAAGAAGGGAAGGGAAGG - Intergenic
1011609317 6:89134813-89134835 AAAGGGATGCAAGATAGGGCAGG + Intergenic
1011650602 6:89502990-89503012 AAGGGGCAGCACTATAGGGAGGG - Intronic
1011757093 6:90510835-90510857 AAAGGGAAGAGGGAAAGGGTAGG - Intergenic
1012313393 6:97755957-97755979 AAAGGGGAGTAGGATAGAAAAGG + Intergenic
1012319046 6:97819806-97819828 AAGGGGAGGCAGAACAGGGAAGG - Intergenic
1012611150 6:101222624-101222646 GAAGGGAAGCAGGAGGGGGAGGG - Intergenic
1013870233 6:114749261-114749283 AAAGGGATGCAGGTCAGGGTAGG + Intergenic
1014186895 6:118445244-118445266 AAAGGGAAGAAAGAGTGGGAAGG - Intergenic
1014270501 6:119330751-119330773 AGAGGGCCGCAGGATAGGAATGG - Intronic
1014448838 6:121560057-121560079 AAAGGGAAGGAAGAAAGGAAAGG - Intergenic
1014688230 6:124530469-124530491 AATGGGAGGCAGGAGAGGTAGGG + Intronic
1014987442 6:128029198-128029220 AGAGGGAGACAGGAGAGGGAAGG - Intronic
1015364643 6:132384307-132384329 AAAAGGAAGAATGAAAGGGAGGG - Intronic
1015591451 6:134826683-134826705 AAAGAAAAGAAGGAGAGGGAAGG + Intergenic
1016062529 6:139645588-139645610 TGAGGGAAGCAAGACAGGGAAGG + Intergenic
1016180764 6:141145479-141145501 AAAGGGAGGCAGGAGAGGCAGGG - Intergenic
1016229853 6:141789341-141789363 AAAGGGAAGATAGATTGGGAAGG + Intergenic
1016266140 6:142234581-142234603 GAAGGGAAGAAGGGAAGGGAAGG - Intergenic
1016747841 6:147600021-147600043 AACAGGCAGCAGGAGAGGGATGG - Intronic
1016763530 6:147767267-147767289 AGAAGGAAGCAGGATAGGGCAGG + Intergenic
1016772809 6:147870790-147870812 AAAGGGAAGAGGGAAGGGGAGGG + Intergenic
1017384113 6:153862320-153862342 AAAGGGGGGAAGGAAAGGGAAGG + Intergenic
1017467803 6:154710960-154710982 ACAGGGAAGGAGGATGGGGCTGG - Intergenic
1017491890 6:154952335-154952357 CAGGGGAAGAAGGATATGGAAGG - Intronic
1017930013 6:158943836-158943858 AGAGGGAAGAAAGAAAGGGAAGG - Intergenic
1018724727 6:166603192-166603214 ACAGGGAAGTAGCAGAGGGAAGG - Intronic
1018869229 6:167768809-167768831 GAAGGGAAGCCCGACAGGGAGGG - Intergenic
1019322966 7:423960-423982 AGAGGGCAGCAGGACAGAGAGGG + Intergenic
1019334968 7:478659-478681 GAAGGGAAGGAGGAAGGGGAGGG + Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019637178 7:2082160-2082182 GAAGGGAGGCAGGAGGGGGAGGG + Intronic
1019878225 7:3834854-3834876 AGAGGGGACCAGGAAAGGGAGGG - Intronic
1019947712 7:4343120-4343142 AAAAGGAAGGAGGGAAGGGAAGG - Intergenic
1019989325 7:4681250-4681272 AAAGGAAGGAAGGAAAGGGAGGG + Intergenic
1020026839 7:4905434-4905456 AAAGGGAAGAAGGAGAGGAATGG + Intergenic
1020129052 7:5549180-5549202 AGAGGGAAGAAGGAGAGGGAAGG + Intronic
1020283496 7:6663667-6663689 GAAGGGAAGGGGGAGAGGGAAGG + Intergenic
1020283544 7:6663789-6663811 GAAGGGAAGAGGGAGAGGGAAGG + Intergenic
1020394936 7:7703963-7703985 GAAGGGAAGGAGGGAAGGGAAGG + Intronic
1020519924 7:9173069-9173091 AAGGGGAAGGATGAGAGGGAAGG - Intergenic
1020580627 7:9995490-9995512 AAAGGGAATCAGGATTGCCAGGG + Intergenic
1020817837 7:12928008-12928030 AAAGGAAAGAAAGAGAGGGAAGG - Intergenic
1021183794 7:17539040-17539062 AAAGGGTGGGAGGAGAGGGAAGG + Intergenic
1022027313 7:26460581-26460603 AAGGAGAAGCAAGAGAGGGAAGG + Intergenic
1022226710 7:28371087-28371109 AAAGGAAAGCAGGAGTGGAAAGG + Intronic
1022599620 7:31745302-31745324 AAATGGAAACAAGATAGGGATGG - Intergenic
1022793890 7:33716650-33716672 GGAGGGAAGCAGGAGAGAGAAGG - Intergenic
1023036616 7:36136714-36136736 AAAGGGTATGGGGATAGGGAAGG - Intergenic
1024070995 7:45785133-45785155 AAAGGGAAGGAGGGAAGGAAAGG - Intergenic
1024084761 7:45884050-45884072 AAAGGGAGGAAGGAGAGAGATGG - Intergenic
1024086611 7:45897068-45897090 AAAGGGAAGGAGGGGAGCGAGGG + Intergenic
1024471106 7:49769563-49769585 AGAGGGAAGAAGGAAAGGAAGGG - Intergenic
1024737752 7:52323559-52323581 AAAGGGAAGGGGGAAAGGAAGGG - Intergenic
1026166973 7:67918858-67918880 GAAAGGAAGCAGGAGAGAGATGG + Intergenic
1026204003 7:68239653-68239675 GAAGGGAAGGAGGAAAGAGAAGG + Intergenic
1026484871 7:70809046-70809068 AAGAGGAAGTAAGATAGGGAGGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026857230 7:73762722-73762744 AAAGGAAAGAAAGAAAGGGAGGG - Intergenic
1026871069 7:73852204-73852226 GGAGGGAAGCAGGGAAGGGAGGG - Intergenic
1026890890 7:73981552-73981574 AGAGGGAGGGAGGAAAGGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027276211 7:76559643-76559665 AAATTGAAACAGGATAGTGAAGG - Intergenic
1027345771 7:77258034-77258056 GGAGGGAAGCAGGATAGAGCTGG + Intronic
1028275710 7:88854582-88854604 AAAGGGAAGGAATAAAGGGAAGG - Intronic
1028427536 7:90706968-90706990 ATGGGGAGGCAGGACAGGGAGGG - Intronic
1028493489 7:91439968-91439990 AAAGGGAAGGAAGGGAGGGAGGG + Intergenic
1028635666 7:92986451-92986473 AAAGGGTAGGTGGATATGGATGG - Intergenic
1028668526 7:93373749-93373771 AGTGGGAAGGAGGATAGGGATGG + Intergenic
1028715061 7:93956234-93956256 AAAGGGAAGCTGGAAGAGGAAGG + Intergenic
1029234777 7:99105944-99105966 AAAGGGATGACGGATTGGGAGGG - Intronic
1029294082 7:99525632-99525654 AAAGTGAGGGAGGTTAGGGAAGG - Intronic
1029300802 7:99580934-99580956 AAAGGGAAGGAAGAGAGGGAAGG - Intronic
1029547214 7:101216872-101216894 AATGGGAAGGAAGAAAGGGAGGG - Intronic
1029584797 7:101463580-101463602 AAAGGGAGGGAGGGAAGGGAAGG - Intronic
1029791829 7:102851463-102851485 AAAGGGAAGAAAGGAAGGGAGGG - Intronic
1030037953 7:105424197-105424219 GAAGGGAAGGAAGAGAGGGAGGG - Intergenic
1030061004 7:105621252-105621274 TAAGGGAACCAGGAGAGAGAGGG - Intronic
1030274779 7:107709058-107709080 TGAGGGGAGCAGGATAGGGAAGG + Intronic
1030857403 7:114578142-114578164 ACAGGCAACAAGGATAGGGAAGG - Intronic
1030869447 7:114737336-114737358 AAAGGCAACCAAGATAGGAAAGG - Intergenic
1031060708 7:117048225-117048247 AAGGGGAGGCAGGAGAGGCAGGG + Intronic
1031151543 7:118059883-118059905 ACAGGGGAGCAGGGGAGGGATGG - Intergenic
1031865595 7:127035810-127035832 AGAGGGAAGCAGTATGGGGATGG - Intronic
1031895190 7:127340189-127340211 AAAGGGAAGGAAGGAAGGGAGGG - Intergenic
1031923167 7:127615759-127615781 TAAGGGAAGCAGGACAGGGCAGG + Intronic
1031989821 7:128190175-128190197 GAGGGGAAGCAGGATTGGGCAGG + Intergenic
1032151010 7:129429759-129429781 ATGGGCAAGTAGGATAGGGAGGG - Exonic
1032226078 7:130032760-130032782 GAAGGGAAGGAGGGAAGGGAGGG + Intronic
1032297621 7:130655551-130655573 AGAAGGAAGGAGGAGAGGGAGGG - Intronic
1032422479 7:131793768-131793790 AAAGAGAAGCAGGGGAAGGAAGG - Intergenic
1032894004 7:136230906-136230928 AAAGGTATGCAGAATTGGGAAGG - Intergenic
1033042008 7:137927413-137927435 GAAGGGAAGCAAGGGAGGGAGGG + Intronic
1033227059 7:139570731-139570753 AAAGGGAGGGAGGATGAGGATGG + Exonic
1033602346 7:142897315-142897337 AGAGGGAAGCTGCAAAGGGAGGG - Intergenic
1033658853 7:143390405-143390427 GACTGGAAGTAGGATAGGGATGG + Intronic
1033666499 7:143445663-143445685 ACAGGGAAGCAGGAGAGGATTGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034013380 7:147555223-147555245 AAAAGGGAGCAGAATAAGGAGGG + Intronic
1034029129 7:147740825-147740847 CAATGGAAGCAGGACAGGGAAGG + Intronic
1034034307 7:147802767-147802789 AAAGGGGAGAGGGAGAGGGAGGG + Intronic
1034393850 7:150805043-150805065 GAAGCGGAGCAGGATGGGGAAGG - Exonic
1034442688 7:151094828-151094850 AGAGGGAAGGAGGGAAGGGAGGG - Intronic
1034581724 7:152049832-152049854 AAAGGGAGGGAGGACTGGGAAGG - Intronic
1034672099 7:152866714-152866736 GAAGGGAAACAGGAAGGGGAAGG - Intergenic
1034944930 7:155255671-155255693 AAGGGGAAGGGGGAGAGGGAGGG + Intergenic
1035188031 7:157140956-157140978 AGAGGGAAGCTGGGTAGGGAAGG + Intronic
1035453327 7:158993097-158993119 AAAGGAAGGCAGGAAGGGGACGG - Intergenic
1035562506 8:616728-616750 ATAGGGAAGCGGGAGAGAGAGGG + Intronic
1035856365 8:2980451-2980473 AAAGAGAAGGAAGAGAGGGATGG - Intronic
1036279360 8:7386382-7386404 AAAAGGAAGAAGGAAAGGGAGGG - Intergenic
1036342154 8:7925490-7925512 AAAAGGAAGAAGGAAAGGGAGGG + Intergenic
1036409329 8:8484275-8484297 CAGGGGAAGCAGGTTAAGGAAGG - Intergenic
1036604508 8:10293728-10293750 AAAGGGAGGGAGGAGAGGGAAGG - Intronic
1036730791 8:11262289-11262311 GGAGTGAAGCAGGATAAGGAAGG - Intergenic
1036978907 8:13446608-13446630 GAAGGGGAGGAGGAGAGGGAAGG + Intronic
1037611545 8:20480396-20480418 AAAGGGAAGGAGGATGGGGGTGG + Intergenic
1037662855 8:20942060-20942082 AAATGGAATCAGGCCAGGGAAGG - Intergenic
1037770811 8:21798358-21798380 AAAAGGAAGCAAGAGAGGGAGGG + Intronic
1037879811 8:22567001-22567023 GAAGGGAAGGAGGCTTGGGAAGG + Intronic
1038274289 8:26107670-26107692 AAAGGGAAGCAGGCCAGGCGAGG + Intergenic
1038596380 8:28890252-28890274 AAAGGGAAGGCGGATGGGCACGG + Intergenic
1038947089 8:32373123-32373145 AAAGGGGAGAAGGGCAGGGAGGG + Intronic
1039069227 8:33634591-33634613 AAAGGCAAAGAGGAGAGGGAGGG + Intergenic
1039887256 8:41661951-41661973 GAAGGGAAGGAGGAAAGGGCTGG + Intronic
1040498200 8:47984942-47984964 AAAGGAAAGGAAGAGAGGGAGGG + Intergenic
1040675921 8:49749768-49749790 AAAGGGAAGGAAGGAAGGGAGGG + Intergenic
1041192753 8:55369552-55369574 AAAGGGAAGGAAGGGAGGGAGGG + Intronic
1041521986 8:58767256-58767278 AAAGAGAGGAAGGATAGAGAGGG + Intergenic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1041880487 8:62744100-62744122 AAAGGAAAGCAGGAGAAAGAAGG + Intronic
1041917876 8:63154128-63154150 TAAGGGAAGGAGTATAAGGAGGG + Intergenic
1042503440 8:69535152-69535174 AAAGCCAAGCGAGATAGGGAAGG - Intronic
1042852790 8:73233561-73233583 ATTGGGAAGCAGGAATGGGAAGG - Intergenic
1042863111 8:73333404-73333426 AAAGGGAAGAAGCATGGGAAAGG + Intergenic
1042883537 8:73522169-73522191 AAAGGAAACAAAGATAGGGAAGG + Intronic
1042951397 8:74203960-74203982 TAAAGGAACCAAGATAGGGAAGG + Intergenic
1043162599 8:76864337-76864359 AAAGGGAAGGAGGAGAAGAAGGG - Exonic
1043183797 8:77119529-77119551 CAATGGAAGCAGGGCAGGGAAGG + Intergenic
1043285961 8:78531776-78531798 AAAGGGAAGGAGGAGAGAGAGGG + Intronic
1043438220 8:80254495-80254517 ATAGGGAATCAGGGTAGGGTGGG - Intergenic
1043509039 8:80931735-80931757 ATAGGGAAGGAAGATTGGGAAGG - Intergenic
1043562087 8:81505113-81505135 AAAGGAAAGCAGGAAAGGGTGGG + Intergenic
1043711315 8:83422426-83422448 AATGGGAAGCTGGATATGAAGGG - Intergenic
1043726210 8:83614243-83614265 GAAGGGAAGGAAGAAAGGGAAGG - Intergenic
1044168450 8:89018636-89018658 GAAGGGAAGAAGGAAGGGGAAGG - Intergenic
1044779733 8:95731839-95731861 AAAGGCAAGCAGAACAGTGAAGG + Intergenic
1044805661 8:96005822-96005844 AAGAGGAAGCAGGTTAGGAAAGG + Intergenic
1044870103 8:96611115-96611137 ACAGGGAAGGAGGGTAGGCAGGG + Exonic
1045011092 8:97958938-97958960 AGAGGGAAGCAGGAGAGGCGTGG - Intronic
1045067483 8:98462380-98462402 AATGGGAAATAGGATAGAGAAGG - Intronic
1045478093 8:102569954-102569976 AAAGGGGTGCAGGAATGGGACGG + Intergenic
1045876291 8:106985150-106985172 GAAGTGAAGCAGGAGAGGGAAGG + Intergenic
1045906779 8:107355231-107355253 AGAGGGAAGCGGGAGAGGGATGG - Intronic
1045922145 8:107544259-107544281 AAAGGGAAGCAAGGATGGGAGGG + Intergenic
1046378026 8:113412695-113412717 GAAGGAAAACAGGATAGGTATGG - Intronic
1046588371 8:116175842-116175864 AAAAGAAAGCAAGAAAGGGAAGG + Intergenic
1046596185 8:116264056-116264078 GAAGAGAGGCAGGATAGAGATGG + Intergenic
1046779953 8:118204374-118204396 GAAGAGAAGCGGGATCGGGAGGG + Intronic
1046910486 8:119621012-119621034 AAAGGGAAGCAGGATAGGGAAGG - Intronic
1046945906 8:119974077-119974099 AAAGGGGAAGAGGAGAGGGAAGG + Intronic
1047242095 8:123099903-123099925 AAAGGGAGGGAGGAATGGGAGGG + Intronic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1047628491 8:126680785-126680807 CCAGGGATGCAGGGTAGGGAAGG - Intergenic
1047718782 8:127619792-127619814 AAGGGGAGGAAGGAGAGGGAAGG - Intergenic
1047794550 8:128241093-128241115 AAAGGAAGGAAGGAAAGGGAAGG - Intergenic
1047815732 8:128460317-128460339 CAAGGGAAGCAGGATAGGGCAGG + Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1048005001 8:130411936-130411958 AAAGGGAACCAGGATGGAAAGGG + Intronic
1048298952 8:133237602-133237624 AAGAGGAAGCAGGAGAGGGAAGG + Exonic
1048511507 8:135066500-135066522 TGAAGGAAGCAGGATAGGGAAGG + Intergenic
1048603800 8:135946834-135946856 AGAGAGAAGCAAGATAGGGAAGG + Intergenic
1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG + Intergenic
1049517593 8:143069649-143069671 AATGGAAAGCTGGATATGGAAGG - Intergenic
1049582154 8:143417673-143417695 AAAGGAAAGCAGGATGGAGATGG - Intergenic
1049606409 8:143531310-143531332 AAAGGGAAGGAAGAAACGGAAGG + Intronic
1049869299 8:144960993-144961015 CAAGGGGCGCAGGATAAGGAGGG + Intergenic
1050096890 9:2076521-2076543 AAAGGGAAGGAAGGAAGGGAGGG - Intronic
1050362614 9:4844960-4844982 AAAAGGAAGCAGGTAAGGTAAGG + Intronic
1050368102 9:4891210-4891232 AGAGGGAAGGAAGAGAGGGAGGG - Intergenic
1050421116 9:5466214-5466236 ATAGGGAAGTAGAATATGGAAGG + Intronic
1050490854 9:6186534-6186556 AAAGGGAAGGAAGGAAGGGAGGG + Intergenic
1050594914 9:7195512-7195534 AAAGGGCAGAAGGAAAGGAAAGG + Intergenic
1051089323 9:13387390-13387412 GAAGGAAAGTAGAATAGGGAAGG - Intergenic
1051233652 9:14977557-14977579 AAAGGGAAGGAAGAAAGGGAGGG + Intergenic
1051734047 9:20179611-20179633 GAAAGGAAGAAGGAAAGGGAAGG + Intergenic
1051886580 9:21899414-21899436 AAGGGGAAGGAGGGGAGGGAAGG + Intronic
1052326005 9:27217317-27217339 AAAGGGAAGCAGGGTGGAAAAGG - Intronic
1052487166 9:29117215-29117237 TGAAGGAAGCAGGATAGGGCAGG + Intergenic
1052505592 9:29350026-29350048 AAAGGGAAGCTTGATATGGGAGG + Intergenic
1053349347 9:37402660-37402682 TAAGGGAAGCTGGAGAGGCAGGG - Intergenic
1053350802 9:37412154-37412176 AGTGGGAAGCAGGAGAGGGGAGG - Intergenic
1053420733 9:37975898-37975920 AAGTGGAAGCAGGAGAGGGGTGG + Intronic
1053462133 9:38279228-38279250 GAGTGGAAGCAGGAGAGGGAGGG - Intergenic
1053485753 9:38454851-38454873 AAAAGGAAGGAAGAAAGGGAAGG - Intergenic
1053679184 9:40469291-40469313 AACGGAAAGCAGGAAAAGGAGGG + Intergenic
1053725095 9:40991684-40991706 GATGGGAACCAGGATAGAGAAGG - Intergenic
1053929171 9:43097643-43097665 AACGGAAAGCAGGAAAAGGAGGG + Intergenic
1054292265 9:63304829-63304851 AACGGAAAGCAGGAAAAGGAGGG + Intergenic
1054340873 9:63860309-63860331 GATGGGAACCAGGATAGAGAAGG + Intergenic
1054505434 9:65907004-65907026 AACGGAAAGCAGGAAAAGGAGGG - Intergenic
1054759918 9:68995189-68995211 GAAGGGAAGAAGGGAAGGGAAGG + Intronic
1054812691 9:69447329-69447351 AGAGGGAAGCTGGTTAGGGATGG - Intronic
1054909456 9:70440768-70440790 AAGGGGAGGAAGGAAAGGGAAGG + Intergenic
1056040065 9:82656138-82656160 GAAGGGAAGAAGGAAGGGGAAGG + Intergenic
1056100135 9:83293166-83293188 AAAAGGAAGGAGGGGAGGGAGGG + Intronic
1056108536 9:83371836-83371858 CAAGGGAAGGAGGAATGGGAAGG + Intronic
1056137767 9:83646631-83646653 AGAGGGAAGGGGGAAAGGGAAGG + Intergenic
1056158653 9:83865590-83865612 AAAGGGTTGGAGGATAGGCAGGG - Intronic
1056350914 9:85748014-85748036 AAAGGGAGGTAAGAAAGGGATGG - Intergenic
1056351911 9:85758347-85758369 AAAGGGTTGGAGGATAGGCAGGG + Intergenic
1056360662 9:85854643-85854665 AAAGGAAGGAAGGAAAGGGAGGG + Intergenic
1056456268 9:86763956-86763978 AAGGGGAAGTAGAAAAGGGAAGG + Intergenic
1056740781 9:89253140-89253162 AAAAGGGAGTAGGAGAGGGATGG - Intergenic
1056860732 9:90178661-90178683 AAGGGGAGGCAGGATAAGCAGGG + Intergenic
1057112435 9:92486080-92486102 GGAGAGAAGCAGGATAGGGGTGG + Intronic
1057179573 9:93022458-93022480 ATAGGGAAGATGGAGAGGGAGGG + Intronic
1057430194 9:94987068-94987090 CATGGGAAGAAGGATAGGAAAGG - Intronic
1058116499 9:101090933-101090955 GGAGGGAAGGAGGATAGGAAGGG - Intronic
1058324647 9:103680294-103680316 GAAGGGAAGAAGGAAAGGGAAGG + Intergenic
1058435675 9:104960959-104960981 AAAAGGATGGAGGAAAGGGAAGG + Intergenic
1058440271 9:105000349-105000371 TGAGGGCAGCAGGACAGGGAAGG - Intergenic
1059283636 9:113154766-113154788 AAAGGCAAAGAGGATAGGGTGGG - Intronic
1059299845 9:113303436-113303458 ACAGGGACTCAGCATAGGGAAGG - Intergenic
1059309935 9:113381354-113381376 AAAGGAAAGAAAGAAAGGGAAGG - Intergenic
1059411377 9:114134526-114134548 AAAGGGGAGCAGGAGAGGGAAGG + Intergenic
1059456168 9:114401664-114401686 GTGGGGAAGCAGGACAGGGAAGG - Intergenic
1059669363 9:116478192-116478214 GAAGGAAAGAAGGAAAGGGAGGG + Intronic
1059814917 9:117901357-117901379 AAAGGGAGGGAGAAGAGGGAGGG + Intergenic
1060029288 9:120200372-120200394 AAAGTGAAGCAGGATAAAGCAGG - Intergenic
1060058213 9:120434325-120434347 GAGGGGAAGCAGGAGAGGGTGGG + Intronic
1060477842 9:123999338-123999360 AGAAGGAAGCCGGAGAGGGAGGG + Intergenic
1060674322 9:125498817-125498839 AAAGGGAAGGAGAGTGGGGAGGG - Intronic
1060939694 9:127536249-127536271 AAAGGCCAGCAGCATTGGGAGGG + Intronic
1060972687 9:127747887-127747909 GAGGGGAAGCTGGATAGGAAAGG - Intronic
1061020791 9:128013247-128013269 TAAGGAAAGGAGAATAGGGAGGG + Intergenic
1061067082 9:128285246-128285268 AAAGGGGGGAAGGAAAGGGAAGG + Intronic
1061521395 9:131120363-131120385 GAAGGGCAGCAAGATCGGGAGGG - Exonic
1061525568 9:131158783-131158805 AAAGGGAAACAGAATGGGTATGG - Intronic
1061595196 9:131624463-131624485 AGAGGGGAGAAGGAAAGGGAGGG - Intronic
1061885724 9:133590180-133590202 AAAGGAAAGAAGGAAAGGAAAGG - Intergenic
1062098047 9:134712694-134712716 AAAGGGAAGCAGAAAAGCCAGGG - Intronic
1062751241 9:138255235-138255257 AAAGGGAAGGAGGGAAGGAAAGG - Intergenic
1203761577 EBV:15038-15060 AAAGGGTAACAGGAGAGGCAGGG - Intergenic
1203762506 EBV:18110-18132 AAAGGGTAACAGGAGAGGCAGGG - Intergenic
1203763435 EBV:21182-21204 AAAGGGTAACAGGAGAGGCAGGG - Intergenic
1203764364 EBV:24254-24276 AAAGGGTAACAGGAGAGGCAGGG - Intergenic
1203765293 EBV:27326-27348 AAAGGGTAACAGGAGAGGCAGGG - Intergenic
1203766222 EBV:30398-30420 AAAGGGTAACAGGAGAGGCAGGG - Intergenic
1203767151 EBV:33470-33492 AAAGGGTAACAGGAGAGGCAGGG - Intergenic
1203527630 Un_GL000213v1:104669-104691 AGAGGCAAGCAGACTAGGGAGGG - Intergenic
1203449722 Un_GL000219v1:100305-100327 GATGGGAACCAGGATAGAGAAGG + Intergenic
1185485976 X:481959-481981 AGAGGGAGGAAGGAGAGGGAGGG + Intergenic
1185492344 X:527244-527266 GAAGGAAAGAAGGAAAGGGAAGG - Intergenic
1185492511 X:528677-528699 GAAGGAAAGAAGGAAAGGGAAGG - Intergenic
1185501743 X:602065-602087 AAAAGGAAGGAGGGAAGGGAAGG - Intergenic
1185581346 X:1213196-1213218 AAAGGGAAGGGGGAGGGGGAGGG - Intergenic
1185698362 X:2213068-2213090 AAAGGAAAGAAGGGAAGGGAAGG + Intergenic
1185711684 X:2308856-2308878 AAAGGGAAGGAGGAAAGGATGGG + Intronic
1185843668 X:3417072-3417094 GAAAGGAAGGAGGAAAGGGAAGG - Intergenic
1185914981 X:4025616-4025638 GAAGGGAAGGAGGGAAGGGAAGG - Intergenic
1186155731 X:6724519-6724541 AAAAGGAAGGAGGAAAGGGTGGG + Intergenic
1186156500 X:6731780-6731802 AAAGGGAAGGAGGGAAGGGACGG + Intergenic
1186237324 X:7527721-7527743 AATTGGAAGCTTGATAGGGATGG - Intergenic
1186521233 X:10208598-10208620 AAAGGGAAGGAAGATGGGGTGGG + Intronic
1186532850 X:10314687-10314709 AATGAGAGGCAGGAGAGGGAAGG + Intergenic
1186621302 X:11243214-11243236 GGAGGGGAGCAGGATAGAGATGG - Intronic
1186747209 X:12582523-12582545 GGAGGGAGGCAGGACAGGGAAGG + Intronic
1187102415 X:16207637-16207659 AAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1187106678 X:16250370-16250392 TAAGTGAAGCCGGATGGGGAAGG - Intergenic
1187179858 X:16934123-16934145 TGAGGGAAGCAGGATGGGGCTGG + Intergenic
1187396981 X:18927382-18927404 AAAGGGAAGGAGTACAGGGATGG + Intronic
1187636880 X:21238711-21238733 AAGGGGAAGGAGGAGTGGGAAGG + Intergenic
1187808656 X:23150522-23150544 AAAGGGAAGGAAGGAAGGGAGGG - Intergenic
1187957697 X:24535983-24536005 AAAGGAAGGAAGGAAAGGGAGGG + Intronic
1188581871 X:31723749-31723771 AGAAGGAAGCTGGAGAGGGAAGG - Intronic
1188605808 X:32028018-32028040 GAAGAGAGGCAGGAGAGGGAGGG + Intronic
1188616215 X:32162212-32162234 GAATGAAAGCAGGATAGGGAAGG + Intronic
1188920534 X:35971205-35971227 TGAGGGAAGCAGAATAGGGAAGG + Intronic
1189131377 X:38501393-38501415 TGAGGGAAGCAGGAAAGGCAGGG - Intronic
1189244190 X:39550570-39550592 TGAGGGAAGCAGGAGAGGGCAGG + Intergenic
1189383156 X:40516265-40516287 ATAGGGAAGCGAGACAGGGAAGG - Intergenic
1189419414 X:40843438-40843460 AAAGGGAAGAAGGGTGGGGCAGG - Intergenic
1189728262 X:43990667-43990689 TGAGGGAAGCAGGATAGAGAAGG - Intergenic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1190203113 X:48381215-48381237 AAAGGGAAGAAGGAAGGGAAGGG - Intergenic
1190207425 X:48414194-48414216 AAAGGGAAGAAGGAAGGGAAGGG + Intergenic
1190291762 X:48997655-48997677 AAAGGGGAGAGGGATTGGGAGGG + Intronic
1190451390 X:50584777-50584799 AGAGGGAATCAGGTTCGGGAGGG + Intergenic
1190845479 X:54186849-54186871 AAAGGGAAGCAGGCCAGGCTTGG + Intergenic
1190939075 X:55023712-55023734 AAAGGGGACCGGAATAGGGAAGG - Intronic
1191842409 X:65522643-65522665 CAAGGGATGCAGGAAATGGAGGG + Intronic
1191896460 X:65998337-65998359 AAAGGAAAGTAGGATGGGGAGGG - Intergenic
1191904819 X:66077017-66077039 GAAGGGAAGAAGGGAAGGGAAGG - Intergenic
1191904827 X:66077040-66077062 GAAGGGAAGAAGGGAAGGGAAGG - Intergenic
1191904833 X:66077058-66077080 GAAGGGAAGAAGGGAAGGGAAGG - Intergenic
1191904839 X:66077076-66077098 GAAGGGAAGAAGGGAAGGGAAGG - Intergenic
1191904862 X:66077148-66077170 GAAGGGAAGGAGGGGAGGGAAGG - Intergenic
1191904873 X:66077179-66077201 GAAGGGAAGGAGGGAAGGGAAGG - Intergenic
1191904894 X:66077231-66077253 GAAGGGAAGGAGGGGAGGGAAGG - Intergenic
1191904900 X:66077244-66077266 GAAGGGAAGGAGGGAAGGGAAGG - Intergenic
1192199899 X:69060236-69060258 AGAGGGAAGGGGGAAAGGGAGGG + Intergenic
1192433111 X:71125877-71125899 AGAGGGAAACAGGGAAGGGAGGG - Intronic
1192552985 X:72068808-72068830 AAGGCAAAGCAGGAGAGGGAGGG + Intergenic
1192617986 X:72647726-72647748 AAAGGGAAGAAGGAAAAGGTTGG + Intronic
1192867930 X:75155791-75155813 AAAGGCAAGCAGGCTGGGAATGG + Intronic
1193739367 X:85199443-85199465 AAAGAAAAGCAGTATATGGAAGG + Intergenic
1193794157 X:85852697-85852719 GACGGGAAGCAGTACAGGGATGG - Intergenic
1194158072 X:90417934-90417956 AAAGGGAAGCAGGATGGGCGTGG + Intergenic
1194268700 X:91783142-91783164 AAAGGGAAGAAGAAAAGGAAGGG - Intronic
1194411279 X:93561736-93561758 AAGAGGAAGAAGGACAGGGAAGG - Intergenic
1194610287 X:96035151-96035173 AAAGGGAAGCAGGATAGGGAAGG - Intergenic
1194650021 X:96503362-96503384 GAAGGGAGGAAGGAAAGGGAAGG + Intergenic
1194719330 X:97322426-97322448 AAAGGAAATGAGGATGGGGAAGG + Intronic
1194976705 X:100403422-100403444 AAAGGGAACCGGGCTAGGGCAGG - Intronic
1195234934 X:102887859-102887881 AAAGGGAAAGAGGAAGGGGAAGG - Intergenic
1195494447 X:105514016-105514038 AAATGGCAGCAGAATGGGGAAGG + Intronic
1195658785 X:107358658-107358680 GAAGTGAAGAAGGAGAGGGAGGG + Intergenic
1196329515 X:114454264-114454286 ATAGAGAAGCAAGATAGGGCAGG + Intergenic
1196843755 X:119882032-119882054 AAAAAGAACCAGGAGAGGGAGGG - Intergenic
1197154920 X:123259914-123259936 GAAGACAACCAGGATAGGGAGGG - Intronic
1197178887 X:123512968-123512990 AAAAGGAAGCAGGATTGGGCAGG - Intergenic
1197266200 X:124374918-124374940 AAAGGGAGGGTGAATAGGGAAGG + Intronic
1197407366 X:126068674-126068696 AAAGGAAATCAGTATATGGAAGG + Intergenic
1197645343 X:129011051-129011073 AAAGGAAAGCACGATAAGGCAGG + Intergenic
1197703438 X:129616837-129616859 AAGGAGAAGAAGGATTGGGATGG + Intergenic
1197761152 X:130029319-130029341 ACTGGGAAGCAGGGTAGGGGAGG - Intronic
1197816554 X:130504510-130504532 AAAGGGAAGGAAGGAAGGGAAGG - Intergenic
1197823613 X:130565907-130565929 AAAGGAAAGCAGAAAAGGAAAGG + Intergenic
1197849017 X:130837037-130837059 AAAGGGAAGAAGCATATGGCAGG + Intronic
1197883265 X:131191442-131191464 AAAGGGAGGGACGAAAGGGAAGG - Intergenic
1198003214 X:132462226-132462248 AAAGAGAAACAGGAGAGAGAGGG - Intronic
1198041795 X:132859909-132859931 AAAGGCAAGCAGGGAAAGGAGGG + Intronic
1198150491 X:133903764-133903786 AAAGGCAAGCAAGAAAGGGGAGG - Intronic
1198319955 X:135510856-135510878 TGAGGGAAGCAGGATAGGGCAGG + Intergenic
1199295533 X:146153605-146153627 AGAAGGAAGCAGGACAGGAAAGG - Intergenic
1199474503 X:148230954-148230976 AGAGGGGAGAAGGAGAGGGAGGG - Intergenic
1199810826 X:151346939-151346961 AATGGGAAGCAGCATAAGGGAGG + Intergenic
1199868372 X:151874615-151874637 AAAGGGAAGCTGGAGAGCTAGGG + Intergenic
1200043152 X:153384429-153384451 CAAGGAAAGCAGGAGAGAGAGGG + Intergenic
1200177429 X:154126594-154126616 AAAGGGAGGCAAGAGTGGGAAGG + Intergenic
1200305558 X:155022864-155022886 TAAGGAAAGGAGGAGAGGGATGG + Intronic
1200504399 Y:3994902-3994924 AAAGGGAAGCAGGCTGGGCGTGG + Intergenic
1200585902 Y:5004058-5004080 AAAGGGAAGAAGAAAAGGAAGGG - Intronic
1200751136 Y:6945243-6945265 AAAGGGAAGAAGAATGGGAAAGG - Intronic
1201183039 Y:11368072-11368094 GAAGGGAAGAAGGGAAGGGAAGG + Intergenic
1201341107 Y:12935517-12935539 GGAGGGAAGGAGGAAAGGGAAGG - Intergenic
1201341129 Y:12935580-12935602 AAAGGGAGGGAGGGAAGGGAAGG - Intergenic
1201451121 Y:14116123-14116145 AGAGGGAAGGAGGAGAGGGGAGG + Intergenic
1201575915 Y:15461158-15461180 AAAGAGAAGAAGGAAAGGAAAGG - Intergenic
1202105882 Y:21364659-21364681 AAAGGGAAGGAAGGAAGGGAGGG - Intergenic