ID: 1046917681

View in Genome Browser
Species Human (GRCh38)
Location 8:119694284-119694306
Sequence CATGAGGTTCTTGTATTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046917681_1046917686 27 Left 1046917681 8:119694284-119694306 CCAACCAATACAAGAACCTCATG No data
Right 1046917686 8:119694334-119694356 AAAATGGAATTGTCCTCTATGGG No data
1046917681_1046917685 26 Left 1046917681 8:119694284-119694306 CCAACCAATACAAGAACCTCATG No data
Right 1046917685 8:119694333-119694355 AAAAATGGAATTGTCCTCTATGG No data
1046917681_1046917684 11 Left 1046917681 8:119694284-119694306 CCAACCAATACAAGAACCTCATG No data
Right 1046917684 8:119694318-119694340 ATTGTTGTTAAGTTCAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046917681 Original CRISPR CATGAGGTTCTTGTATTGGT TGG (reversed) Intergenic
No off target data available for this crispr