ID: 1046920799

View in Genome Browser
Species Human (GRCh38)
Location 8:119726276-119726298
Sequence TGGATTCAAACCCAAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046920799_1046920803 10 Left 1046920799 8:119726276-119726298 CCAGGCCCTTGGGTTTGAATCCA No data
Right 1046920803 8:119726309-119726331 CATACAAGCTGTATGACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046920799 Original CRISPR TGGATTCAAACCCAAGGGCC TGG (reversed) Intergenic
No off target data available for this crispr