ID: 1046923243

View in Genome Browser
Species Human (GRCh38)
Location 8:119757236-119757258
Sequence GTGTAAAATAAGACTACGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046923241_1046923243 3 Left 1046923241 8:119757210-119757232 CCTCTTGTGCTTTGAAATTTAAG 0: 1
1: 0
2: 1
3: 27
4: 297
Right 1046923243 8:119757236-119757258 GTGTAAAATAAGACTACGGAAGG No data
1046923240_1046923243 27 Left 1046923240 8:119757186-119757208 CCTAAAAGATGTAGATTCTAACA 0: 1
1: 0
2: 0
3: 17
4: 244
Right 1046923243 8:119757236-119757258 GTGTAAAATAAGACTACGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046923243 Original CRISPR GTGTAAAATAAGACTACGGA AGG Intronic
No off target data available for this crispr