ID: 1046925392

View in Genome Browser
Species Human (GRCh38)
Location 8:119781535-119781557
Sequence CAGGCACCCGCCATCATGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046925392_1046925396 -2 Left 1046925392 8:119781535-119781557 CCGGGCATGATGGCGGGTGCCTG No data
Right 1046925396 8:119781556-119781578 TGTAATCCCAGCTACTTGGGAGG No data
1046925392_1046925399 7 Left 1046925392 8:119781535-119781557 CCGGGCATGATGGCGGGTGCCTG No data
Right 1046925399 8:119781565-119781587 AGCTACTTGGGAGGCTGATGTGG No data
1046925392_1046925393 -6 Left 1046925392 8:119781535-119781557 CCGGGCATGATGGCGGGTGCCTG No data
Right 1046925393 8:119781552-119781574 TGCCTGTAATCCCAGCTACTTGG No data
1046925392_1046925400 8 Left 1046925392 8:119781535-119781557 CCGGGCATGATGGCGGGTGCCTG No data
Right 1046925400 8:119781566-119781588 GCTACTTGGGAGGCTGATGTGGG No data
1046925392_1046925394 -5 Left 1046925392 8:119781535-119781557 CCGGGCATGATGGCGGGTGCCTG No data
Right 1046925394 8:119781553-119781575 GCCTGTAATCCCAGCTACTTGGG No data
1046925392_1046925402 30 Left 1046925392 8:119781535-119781557 CCGGGCATGATGGCGGGTGCCTG No data
Right 1046925402 8:119781588-119781610 GAGAACTGCTTGACTCAGGACGG No data
1046925392_1046925401 26 Left 1046925392 8:119781535-119781557 CCGGGCATGATGGCGGGTGCCTG No data
Right 1046925401 8:119781584-119781606 GTGGGAGAACTGCTTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046925392 Original CRISPR CAGGCACCCGCCATCATGCC CGG (reversed) Intronic