ID: 1046925395

View in Genome Browser
Species Human (GRCh38)
Location 8:119781554-119781576
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1337359
Summary {0: 48553, 1: 142115, 2: 242012, 3: 520212, 4: 384467}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046925395_1046925407 18 Left 1046925395 8:119781554-119781576 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1046925407 8:119781595-119781617 GCTTGACTCAGGACGGGGAGGGG No data
1046925395_1046925403 12 Left 1046925395 8:119781554-119781576 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1046925403 8:119781589-119781611 AGAACTGCTTGACTCAGGACGGG No data
1046925395_1046925405 16 Left 1046925395 8:119781554-119781576 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1046925405 8:119781593-119781615 CTGCTTGACTCAGGACGGGGAGG No data
1046925395_1046925401 7 Left 1046925395 8:119781554-119781576 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1046925401 8:119781584-119781606 GTGGGAGAACTGCTTGACTCAGG No data
1046925395_1046925409 22 Left 1046925395 8:119781554-119781576 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1046925409 8:119781599-119781621 GACTCAGGACGGGGAGGGGGAGG No data
1046925395_1046925406 17 Left 1046925395 8:119781554-119781576 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1046925406 8:119781594-119781616 TGCTTGACTCAGGACGGGGAGGG No data
1046925395_1046925402 11 Left 1046925395 8:119781554-119781576 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1046925402 8:119781588-119781610 GAGAACTGCTTGACTCAGGACGG No data
1046925395_1046925408 19 Left 1046925395 8:119781554-119781576 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1046925408 8:119781596-119781618 CTTGACTCAGGACGGGGAGGGGG No data
1046925395_1046925404 13 Left 1046925395 8:119781554-119781576 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1046925404 8:119781590-119781612 GAACTGCTTGACTCAGGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046925395 Original CRISPR TCCCAAGTAGCTGGGATTAC AGG (reversed) Intronic