ID: 1046925397

View in Genome Browser
Species Human (GRCh38)
Location 8:119781562-119781584
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046925397_1046925408 11 Left 1046925397 8:119781562-119781584 CCCAGCTACTTGGGAGGCTGATG No data
Right 1046925408 8:119781596-119781618 CTTGACTCAGGACGGGGAGGGGG No data
1046925397_1046925402 3 Left 1046925397 8:119781562-119781584 CCCAGCTACTTGGGAGGCTGATG No data
Right 1046925402 8:119781588-119781610 GAGAACTGCTTGACTCAGGACGG No data
1046925397_1046925403 4 Left 1046925397 8:119781562-119781584 CCCAGCTACTTGGGAGGCTGATG No data
Right 1046925403 8:119781589-119781611 AGAACTGCTTGACTCAGGACGGG No data
1046925397_1046925405 8 Left 1046925397 8:119781562-119781584 CCCAGCTACTTGGGAGGCTGATG No data
Right 1046925405 8:119781593-119781615 CTGCTTGACTCAGGACGGGGAGG No data
1046925397_1046925404 5 Left 1046925397 8:119781562-119781584 CCCAGCTACTTGGGAGGCTGATG No data
Right 1046925404 8:119781590-119781612 GAACTGCTTGACTCAGGACGGGG No data
1046925397_1046925409 14 Left 1046925397 8:119781562-119781584 CCCAGCTACTTGGGAGGCTGATG No data
Right 1046925409 8:119781599-119781621 GACTCAGGACGGGGAGGGGGAGG No data
1046925397_1046925407 10 Left 1046925397 8:119781562-119781584 CCCAGCTACTTGGGAGGCTGATG No data
Right 1046925407 8:119781595-119781617 GCTTGACTCAGGACGGGGAGGGG No data
1046925397_1046925401 -1 Left 1046925397 8:119781562-119781584 CCCAGCTACTTGGGAGGCTGATG No data
Right 1046925401 8:119781584-119781606 GTGGGAGAACTGCTTGACTCAGG No data
1046925397_1046925406 9 Left 1046925397 8:119781562-119781584 CCCAGCTACTTGGGAGGCTGATG No data
Right 1046925406 8:119781594-119781616 TGCTTGACTCAGGACGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046925397 Original CRISPR CATCAGCCTCCCAAGTAGCT GGG (reversed) Intronic