ID: 1046925398

View in Genome Browser
Species Human (GRCh38)
Location 8:119781563-119781585
Sequence ACATCAGCCTCCCAAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 643740
Summary {0: 203, 1: 14557, 2: 116457, 3: 228136, 4: 284387}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046925398_1046925408 10 Left 1046925398 8:119781563-119781585 CCAGCTACTTGGGAGGCTGATGT 0: 203
1: 14557
2: 116457
3: 228136
4: 284387
Right 1046925408 8:119781596-119781618 CTTGACTCAGGACGGGGAGGGGG No data
1046925398_1046925402 2 Left 1046925398 8:119781563-119781585 CCAGCTACTTGGGAGGCTGATGT 0: 203
1: 14557
2: 116457
3: 228136
4: 284387
Right 1046925402 8:119781588-119781610 GAGAACTGCTTGACTCAGGACGG No data
1046925398_1046925404 4 Left 1046925398 8:119781563-119781585 CCAGCTACTTGGGAGGCTGATGT 0: 203
1: 14557
2: 116457
3: 228136
4: 284387
Right 1046925404 8:119781590-119781612 GAACTGCTTGACTCAGGACGGGG No data
1046925398_1046925407 9 Left 1046925398 8:119781563-119781585 CCAGCTACTTGGGAGGCTGATGT 0: 203
1: 14557
2: 116457
3: 228136
4: 284387
Right 1046925407 8:119781595-119781617 GCTTGACTCAGGACGGGGAGGGG No data
1046925398_1046925401 -2 Left 1046925398 8:119781563-119781585 CCAGCTACTTGGGAGGCTGATGT 0: 203
1: 14557
2: 116457
3: 228136
4: 284387
Right 1046925401 8:119781584-119781606 GTGGGAGAACTGCTTGACTCAGG No data
1046925398_1046925406 8 Left 1046925398 8:119781563-119781585 CCAGCTACTTGGGAGGCTGATGT 0: 203
1: 14557
2: 116457
3: 228136
4: 284387
Right 1046925406 8:119781594-119781616 TGCTTGACTCAGGACGGGGAGGG No data
1046925398_1046925409 13 Left 1046925398 8:119781563-119781585 CCAGCTACTTGGGAGGCTGATGT 0: 203
1: 14557
2: 116457
3: 228136
4: 284387
Right 1046925409 8:119781599-119781621 GACTCAGGACGGGGAGGGGGAGG No data
1046925398_1046925405 7 Left 1046925398 8:119781563-119781585 CCAGCTACTTGGGAGGCTGATGT 0: 203
1: 14557
2: 116457
3: 228136
4: 284387
Right 1046925405 8:119781593-119781615 CTGCTTGACTCAGGACGGGGAGG No data
1046925398_1046925403 3 Left 1046925398 8:119781563-119781585 CCAGCTACTTGGGAGGCTGATGT 0: 203
1: 14557
2: 116457
3: 228136
4: 284387
Right 1046925403 8:119781589-119781611 AGAACTGCTTGACTCAGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046925398 Original CRISPR ACATCAGCCTCCCAAGTAGC TGG (reversed) Intronic
Too many off-targets to display for this crispr