ID: 1046925401

View in Genome Browser
Species Human (GRCh38)
Location 8:119781584-119781606
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046925392_1046925401 26 Left 1046925392 8:119781535-119781557 CCGGGCATGATGGCGGGTGCCTG 0: 297
1: 3838
2: 18933
3: 55167
4: 107029
Right 1046925401 8:119781584-119781606 GTGGGAGAACTGCTTGACTCAGG No data
1046925397_1046925401 -1 Left 1046925397 8:119781562-119781584 CCCAGCTACTTGGGAGGCTGATG 0: 631
1: 99326
2: 210877
3: 251452
4: 266234
Right 1046925401 8:119781584-119781606 GTGGGAGAACTGCTTGACTCAGG No data
1046925398_1046925401 -2 Left 1046925398 8:119781563-119781585 CCAGCTACTTGGGAGGCTGATGT 0: 203
1: 14557
2: 116457
3: 228136
4: 284387
Right 1046925401 8:119781584-119781606 GTGGGAGAACTGCTTGACTCAGG No data
1046925395_1046925401 7 Left 1046925395 8:119781554-119781576 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1046925401 8:119781584-119781606 GTGGGAGAACTGCTTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr