ID: 1046925403

View in Genome Browser
Species Human (GRCh38)
Location 8:119781589-119781611
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046925397_1046925403 4 Left 1046925397 8:119781562-119781584 CCCAGCTACTTGGGAGGCTGATG 0: 631
1: 99326
2: 210877
3: 251452
4: 266234
Right 1046925403 8:119781589-119781611 AGAACTGCTTGACTCAGGACGGG No data
1046925398_1046925403 3 Left 1046925398 8:119781563-119781585 CCAGCTACTTGGGAGGCTGATGT 0: 203
1: 14557
2: 116457
3: 228136
4: 284387
Right 1046925403 8:119781589-119781611 AGAACTGCTTGACTCAGGACGGG No data
1046925395_1046925403 12 Left 1046925395 8:119781554-119781576 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1046925403 8:119781589-119781611 AGAACTGCTTGACTCAGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr