ID: 1046925408

View in Genome Browser
Species Human (GRCh38)
Location 8:119781596-119781618
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046925398_1046925408 10 Left 1046925398 8:119781563-119781585 CCAGCTACTTGGGAGGCTGATGT No data
Right 1046925408 8:119781596-119781618 CTTGACTCAGGACGGGGAGGGGG No data
1046925397_1046925408 11 Left 1046925397 8:119781562-119781584 CCCAGCTACTTGGGAGGCTGATG No data
Right 1046925408 8:119781596-119781618 CTTGACTCAGGACGGGGAGGGGG No data
1046925395_1046925408 19 Left 1046925395 8:119781554-119781576 CCTGTAATCCCAGCTACTTGGGA No data
Right 1046925408 8:119781596-119781618 CTTGACTCAGGACGGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type