ID: 1046932491

View in Genome Browser
Species Human (GRCh38)
Location 8:119855620-119855642
Sequence CTGTGCCAGCAGCTGGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 1, 2: 7, 3: 60, 4: 551}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046932491_1046932500 27 Left 1046932491 8:119855620-119855642 CCATCCTCCAGCTGCTGGCACAG 0: 1
1: 1
2: 7
3: 60
4: 551
Right 1046932500 8:119855670-119855692 GTCGCCGGCTGCAGCGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 131
1046932491_1046932496 -1 Left 1046932491 8:119855620-119855642 CCATCCTCCAGCTGCTGGCACAG 0: 1
1: 1
2: 7
3: 60
4: 551
Right 1046932496 8:119855642-119855664 GCGTGGGCTCCAGCTCCAGCAGG 0: 1
1: 0
2: 2
3: 40
4: 285
1046932491_1046932498 12 Left 1046932491 8:119855620-119855642 CCATCCTCCAGCTGCTGGCACAG 0: 1
1: 1
2: 7
3: 60
4: 551
Right 1046932498 8:119855655-119855677 CTCCAGCAGGCAGAAGTCGCCGG 0: 1
1: 0
2: 1
3: 37
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046932491 Original CRISPR CTGTGCCAGCAGCTGGAGGA TGG (reversed) Exonic
900104060 1:974735-974757 TGGTGCCAGCAGCTGGGGCAGGG + Exonic
900139259 1:1132636-1132658 TTGTTCCAGCAGCTGGAGCTAGG - Intergenic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
900358235 1:2274995-2275017 GTGTGTCAGCAGGTGGAGGCTGG + Intronic
900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG + Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900391282 1:2435061-2435083 CTTTGTCAGCAGCAGGAGGCAGG + Intronic
900565318 1:3329154-3329176 CTGTCCCAGCAGTTGTAGGTAGG + Intronic
900993874 1:6109979-6110001 CTGCTCCAGCAGCTGGGGGCGGG + Exonic
901747765 1:11385836-11385858 CAGAGCCAAAAGCTGGAGGAAGG - Intergenic
902548932 1:17208004-17208026 CTGGGCTGGCAGCAGGAGGAAGG + Intronic
902820067 1:18938323-18938345 CCTTCCCAGCAGCTGGAGGTGGG - Intronic
902985793 1:20153285-20153307 CTGCGGCAGCCTCTGGAGGAAGG - Intergenic
903058432 1:20653017-20653039 CTCTGCCTGCAGGTGGTGGAAGG - Intronic
903257860 1:22114705-22114727 CAGTGCCTGCTGCGGGAGGAGGG - Intergenic
903577820 1:24350139-24350161 CTGAGCAACCAGCTGGGGGAGGG - Intronic
903787328 1:25870113-25870135 CTGAGCCAGCAGGATGAGGATGG + Intronic
904194552 1:28775348-28775370 CCGTGCCTGCGGATGGAGGAGGG + Intergenic
904659273 1:32072788-32072810 CTTCACCAGCAGCTGCAGGAAGG + Intronic
905064342 1:35167153-35167175 TAGTGACAGAAGCTGGAGGATGG + Intergenic
905504368 1:38465498-38465520 CTGGGCCAGAGGCAGGAGGAGGG - Intergenic
905871009 1:41404628-41404650 CTGTGCTGGGAGCTGGGGGAGGG + Intergenic
906285558 1:44585401-44585423 CTGTTCCAGAAGTTGGAGGGAGG - Intronic
906322988 1:44828141-44828163 CTGCCCCAGGAGCTGGGGGACGG - Exonic
907297986 1:53467782-53467804 CTATGGAAGGAGCTGGAGGAAGG - Intergenic
908813964 1:68012633-68012655 CTGTGCCTGCTGCAGGTGGAAGG - Intergenic
908985045 1:70007283-70007305 CTGTGCCAAGAACTGGATGAAGG + Intronic
910366287 1:86468701-86468723 CTGTGCCAGATGCTGGGGTAAGG - Exonic
911188799 1:94927550-94927572 GTGTTCCAGCAGCGGGCGGAGGG - Intergenic
911830950 1:102550859-102550881 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
912499391 1:110112117-110112139 CTGTGCCAGCACCTGGACCTGGG - Intergenic
912681900 1:111734129-111734151 CTGTGCCAAGAGCTGTAGGAGGG + Intronic
913975266 1:143450579-143450601 CTATACCAGCAGCTGGTGCAGGG - Intergenic
914069659 1:144276195-144276217 CTGTACCAGCAGCTGGCGCAGGG - Intergenic
914109496 1:144690159-144690181 CTGTACCAGCAGCTGGCGCAGGG + Intergenic
915557045 1:156666626-156666648 CTGTGCCAGACGGTGGAGGAGGG - Intergenic
915718864 1:157968906-157968928 CTGTGCAAGCTGATGAAGGAGGG - Intergenic
915900317 1:159842037-159842059 CTGTGTAAGCATCTGGGGGAAGG + Intronic
916412548 1:164559886-164559908 CTGTCCCAGCACTTGCAGGATGG + Exonic
916770818 1:167905864-167905886 CTGCCCCAGCAGCTACAGGAAGG - Intronic
916791519 1:168129475-168129497 CTGTGCCTGCTGCTGGGTGAAGG + Intronic
917837750 1:178954201-178954223 CTGTGTCAGAAGCTGCTGGAAGG - Intergenic
918854563 1:189734186-189734208 CTGTGACTGCAGCTGCATGAGGG + Intergenic
919083727 1:192895610-192895632 CTGAGCCAGCAGCCGGAAGCCGG - Intergenic
920077562 1:203348238-203348260 CCCTGCCAGCAGCAGGAGGGAGG + Exonic
920295036 1:204950830-204950852 CTGTGCCAGCCACTGGAGGATGG - Intronic
920455733 1:206099719-206099741 CTTTGACAGCAGGTGGATGATGG - Exonic
920587246 1:207178406-207178428 GGGTGCCAGAGGCTGGAGGAGGG - Intergenic
921030034 1:211328402-211328424 CTGAGCCAGCATCTGGAACATGG + Intronic
921850420 1:219927959-219927981 CAGCGGCAGCAGCTGGCGGAGGG - Exonic
922059792 1:222077400-222077422 ATGTGGCAGCAGCAGGAGGTTGG - Intergenic
922578253 1:226677641-226677663 CTGTGCCAGAGGCTGCAAGATGG + Intronic
922972860 1:229757867-229757889 CTATTCCAGTAGCTGGAAGAAGG + Intergenic
923519502 1:234725014-234725036 CTCTGCCTGCTGCTGGAGCATGG + Intergenic
924599727 1:245477996-245478018 GGGTGCCAGCGGCTGGAAGAGGG - Intronic
924638777 1:245813390-245813412 CTGTGCTTGCACCTGGGGGAAGG - Intronic
924823593 1:247518044-247518066 CTGTGGCAGGAGGTGGAGAAGGG - Intronic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1063762250 10:9093087-9093109 CTGTGTCCTCACCTGGAGGAAGG - Intergenic
1063958647 10:11287971-11287993 ATGTGGCAGCAGCTGGAGGAAGG - Intronic
1065143589 10:22743964-22743986 CTGTGCCAGGTGCTGGAAAAGGG + Intergenic
1065282266 10:24151483-24151505 CTATGACAGGCGCTGGAGGAAGG + Intronic
1066037897 10:31512207-31512229 TGGTGGCAGCAGCTGCAGGATGG - Intronic
1066240976 10:33534590-33534612 ATGTACCAGGGGCTGGAGGATGG + Intergenic
1066491518 10:35899328-35899350 CCGTGGCTGCAGATGGAGGATGG + Intergenic
1066680225 10:37930977-37930999 CTGTGACAGCTGATGGAGAAGGG - Intergenic
1067081528 10:43215223-43215245 ATCTGCCAGGAGGTGGAGGAGGG + Intronic
1067669012 10:48302928-48302950 CAGTTCTTGCAGCTGGAGGATGG + Intergenic
1067750685 10:48969291-48969313 CTCTGCCTCCAGCTGGAGGAAGG - Intronic
1068252135 10:54456235-54456257 CTGTGAAAGCAGCTGAAGGGGGG + Intronic
1068550324 10:58400627-58400649 CTGGGCCAGAATCTGGAGGGTGG + Intergenic
1069033485 10:63623448-63623470 CTCTGCCAGCACATGGAGCACGG + Exonic
1069599601 10:69694968-69694990 GAGTCCCAGCAGCTGGAGGATGG - Intergenic
1069691039 10:70352912-70352934 GGTTGCCAGCAGCTGGGGGATGG - Intronic
1072419014 10:95273699-95273721 CTGTCCCAGTGGCTGGATGAGGG - Intronic
1072610140 10:97012537-97012559 CTGTGCTAGCAGCTCCAGGCTGG + Intronic
1072671634 10:97434261-97434283 CTGTGCCACCCACTGGATGAGGG + Intergenic
1073190905 10:101650104-101650126 TTGTGCCAGGAGCTTGGGGATGG - Intronic
1073219598 10:101859338-101859360 CTGAGACAGCAGCTGCAGGAAGG + Intronic
1073262487 10:102201089-102201111 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1073525537 10:104178217-104178239 CTTTGACTGGAGCTGGAGGATGG + Intronic
1074198126 10:111207280-111207302 CAGTGCTAGCAGCTGGGTGAAGG - Intergenic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1075139455 10:119818476-119818498 CAGTGCCTGCGGCTGGAGGGGGG - Intronic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1076314868 10:129532949-129532971 GTGTCCGAGCAGCTGCAGGAAGG - Intronic
1076539896 10:131207200-131207222 CTGTGCCTGGAGCTGGAGATTGG - Intronic
1076757478 10:132580014-132580036 CCCTGCCAGCAGTGGGAGGAAGG - Intronic
1076778186 10:132709599-132709621 CTGGGCCACAGGCTGGAGGAGGG + Intronic
1076865888 10:133166105-133166127 CAGTGCCAGCCGCTGGGGCAGGG + Intronic
1076992134 11:280926-280948 CTGCGCCAGCAGCTGGAGCTCGG + Exonic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1077048965 11:558237-558259 CTGTGGGAGCTCCTGGAGGAGGG + Exonic
1077110028 11:858269-858291 ATGCACCAGCAGCTGGGGGATGG - Intronic
1077359463 11:2134278-2134300 AGGTGCCATCAGCCGGAGGAGGG + Intronic
1077713701 11:4559926-4559948 CTGGGACAGCACCTGGAGGGAGG + Intergenic
1077919300 11:6631053-6631075 CTGCACCAGCAGCTGGAGGCTGG + Exonic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078858589 11:15226708-15226730 CCATGCCAGCAGCTGCAGGAAGG + Intronic
1079043573 11:17080245-17080267 CAGTGCCAACAGCAAGAGGAAGG - Intronic
1079087585 11:17457849-17457871 CTGTGCCAACTGCTGCAGGATGG + Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079803173 11:24896431-24896453 CTGGGCCAGCAGCTGCAGAGGGG + Intronic
1080443789 11:32318599-32318621 CTGAGTCAACAGCTGGAGGTAGG + Intergenic
1080596760 11:33780026-33780048 CAGTTCTAGCAGCTGGAGGGAGG - Intergenic
1080848561 11:36047817-36047839 CTGTGCCAGCTGCTGTTTGAAGG - Intronic
1081445576 11:43128785-43128807 CTGTGTCATCACATGGAGGAAGG - Intergenic
1082213100 11:49530387-49530409 GTTTGCCAGAAGCTGGGGGAGGG - Intergenic
1082708120 11:56518699-56518721 CTGTGTCAGCCCATGGAGGAAGG + Intergenic
1083200668 11:61119240-61119262 CTGTGCCACCAGCTGCAGCCTGG - Exonic
1083738527 11:64695230-64695252 CTTTTCCAGCAGTGGGAGGAGGG - Intronic
1083779851 11:64912150-64912172 CTGAACCAGCAGCTGCAGGCAGG - Exonic
1083903232 11:65654055-65654077 GAGTACCAGAAGCTGGAGGATGG + Exonic
1084502398 11:69542563-69542585 CTCTGCCAGCATCTGCAGGCGGG + Intergenic
1084549579 11:69833153-69833175 CTGTCCCAGCTGCTGGTGCACGG + Intergenic
1084732856 11:71084547-71084569 CTGTTCTAGCACCTGGAGAATGG - Intronic
1085172645 11:74462248-74462270 CTGACCCAGCTGCTGCAGGAAGG - Intronic
1086636497 11:89094130-89094152 GTTTGCCAGAAGCTGGGGGAGGG + Intergenic
1087125972 11:94626069-94626091 CTGTGCAAGCAACAGGAGGGGGG - Intergenic
1087782645 11:102317662-102317684 ATGTGCCAGCGGCTGGCCGAGGG + Intronic
1088707409 11:112476233-112476255 CAGTGCCAGAAGCTGCAGAAAGG - Intergenic
1088879568 11:113962926-113962948 CTGTGCAAGCAACAGAAGGAAGG + Intergenic
1089064420 11:115651628-115651650 ATTTGCCAGGAGCTGGAGGAAGG - Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089816759 11:121182984-121183006 CAGTGGCAGCAGCTGCAGGCAGG + Intronic
1090743471 11:129688031-129688053 CTGTTCCAGCACTGGGAGGAGGG - Intergenic
1092029877 12:5275276-5275298 CTGTGCCACAGGCTGGAGCAGGG - Intergenic
1092045576 12:5430229-5430251 CAGGGCGAGAAGCTGGAGGAGGG + Intergenic
1092521944 12:9284484-9284506 GTGCTCCACCAGCTGGAGGATGG - Intergenic
1092545338 12:9447372-9447394 GTGCTCCACCAGCTGGAGGATGG + Intergenic
1094000152 12:25686390-25686412 CTGGGCCAGCAGCTGCGGAAGGG + Intergenic
1094507613 12:31074678-31074700 GTGCTCCACCAGCTGGAGGATGG - Intronic
1094808034 12:34109527-34109549 CTGTACCAGGAGCTGCAGGGTGG - Intergenic
1095554580 12:43485007-43485029 CTGTTCCAAAAGATGGAGGAGGG + Intronic
1095616075 12:44190694-44190716 TTGTGCCAGAAACTGGATGAGGG - Intronic
1096460773 12:51820591-51820613 CTGTGCCAGCAGGCGGCGGCCGG - Intergenic
1096684354 12:53277938-53277960 CTTTGCCACCAGCTGGTAGAGGG - Exonic
1096941600 12:55352394-55352416 CTGTGCCAACTCCTGGGGGAGGG + Intergenic
1097333629 12:58358358-58358380 CTGTGCTAGGTGCTGGAGGGCGG + Intergenic
1097360437 12:58653809-58653831 CTGTGAAAGCAGCTGGGTGAGGG - Intronic
1097496086 12:60336904-60336926 GGTTGCCAGGAGCTGGAGGATGG - Intergenic
1098701430 12:73632760-73632782 CTCTGCCAGCAGCTGGGTCAAGG - Intergenic
1100776393 12:97979470-97979492 CAGTGGCAGCAGCTGTAGGCAGG - Intergenic
1101111379 12:101489886-101489908 TGGTGACAGAAGCTGGAGGAGGG + Intergenic
1101432867 12:104641388-104641410 CTGTGGCAGCATCTAGGGGAGGG - Intronic
1101495699 12:105252141-105252163 CATTGCCAGGAGCTGGAGGGAGG + Intronic
1101772886 12:107767690-107767712 CTGCCCCATCCGCTGGAGGAAGG - Intergenic
1102158714 12:110751319-110751341 CTATCCCAGCATCTGGAGGGTGG + Intergenic
1102462267 12:113107198-113107220 CTGGGCCAGCAGCTGGGCCAAGG - Exonic
1102570088 12:113822275-113822297 CTGTGCCAGCACCAGGCAGAGGG - Intronic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1103164031 12:118754835-118754857 CTGAGCCACTGGCTGGAGGAGGG - Intergenic
1103623119 12:122200804-122200826 CCGGCCCAGCACCTGGAGGATGG - Exonic
1103713553 12:122930022-122930044 CTGGGCCAGCAGCTGCTGGTGGG + Exonic
1103900034 12:124298688-124298710 GTGTGGCAGCAGCAGGTGGATGG + Intronic
1104024748 12:125017658-125017680 CTGTGCCAGCAGATCTAGAATGG - Intronic
1104327734 12:127816005-127816027 CTGTGCCCTCACATGGAGGAAGG - Intergenic
1104559964 12:129834545-129834567 CAGTGCTAGCAGCTGGTGCATGG - Intronic
1104600412 12:130149659-130149681 CAGGGCCAGGAGCTGGAGAATGG + Intergenic
1104892894 12:132148830-132148852 CTGCGCCAGCTGCGGCAGGATGG - Exonic
1105207968 13:18238895-18238917 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1105305988 13:19169603-19169625 ATGGGCCAGCATCTGCAGGAAGG + Intergenic
1105737337 13:23285216-23285238 CTGGGACAGCACCTGGGGGAAGG - Intronic
1105963665 13:25366036-25366058 ATCTGGCAGCAGCTTGAGGATGG + Intergenic
1106293893 13:28392283-28392305 ATGTGCCAGAAGATGCAGGAGGG + Intronic
1106358249 13:29005310-29005332 CTGGCCCAGCAGCTGGAGAGGGG + Intronic
1106877359 13:34088470-34088492 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1107015365 13:35704663-35704685 CTGTGCCAGCTCAGGGAGGAGGG - Intergenic
1109416450 13:62046759-62046781 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1111711116 13:91815618-91815640 CATTGACAGCAGCTGGAGGGAGG - Intronic
1111828342 13:93296603-93296625 CTGTGCCAGCCACTGTAGTAGGG - Intronic
1112061287 13:95742069-95742091 CAGTGGCAGCAGCTGTAGGCAGG + Intronic
1112414326 13:99191793-99191815 CTGAGCCAGCAGGTTTAGGAGGG - Intergenic
1112815915 13:103272932-103272954 GATTGCCAGAAGCTGGAGGAGGG + Intergenic
1113078537 13:106492428-106492450 TGTTGCCAGCGGCTGGAGGAGGG + Exonic
1113830110 13:113289014-113289036 CTCTGTCAGCAGCTGGAGCCAGG + Intergenic
1113846437 13:113394223-113394245 CTGTCCCTGCAGGTGCAGGAGGG + Intergenic
1114499195 14:23155417-23155439 CTGCGCCAGCTGCTGGAGCTGGG + Intronic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1116207916 14:41891904-41891926 CTGTGACAGAATCGGGAGGACGG - Exonic
1118256422 14:64209707-64209729 CTGTCTCAGCAGCTGGGGGCAGG - Intronic
1118753557 14:68822899-68822921 CTGTGACAGCAGCAGGGGGTGGG - Intergenic
1119428907 14:74552958-74552980 CTGTGCCAACAGCTGTGAGAGGG - Exonic
1119483352 14:74973528-74973550 CGCAGCCAGCAGCTGGGGGAAGG + Intergenic
1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG + Intronic
1120668258 14:87333224-87333246 CTGGACCAGCTGCTAGAGGAGGG + Intergenic
1120787464 14:88550528-88550550 CTGGGTGAGCAGCTGGAGGCCGG - Exonic
1121989407 14:98541117-98541139 GTTTGCCAACAGCTGGTGGAGGG - Intergenic
1124089703 15:26586874-26586896 TGGTGGCAGAAGCTGGAGGAGGG + Intronic
1124986370 15:34620064-34620086 CATTGACAGCAGCTGGAGGGAGG - Intergenic
1125427228 15:39561130-39561152 CTGTGACTGAAGCTAGAGGAAGG + Intergenic
1126031240 15:44500063-44500085 GTTTGCCAGCAGGTGGAGGCAGG + Intronic
1126807000 15:52360973-52360995 CTTTTCCAGCAGCTGGGGAAAGG - Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127070266 15:55282024-55282046 CTGTGCCAGCTGCTGGTTAAAGG - Intronic
1127187558 15:56494949-56494971 CTTTTCCAACAGCTGGATGATGG - Intergenic
1128352920 15:66903398-66903420 GTGTGACAGCAGCTGGAGCTGGG + Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128572259 15:68742374-68742396 CTGTGCAAGCTGCTGGAGGAAGG - Intergenic
1128727098 15:69996278-69996300 CTGTGTCAGCATTTGGGGGAAGG + Intergenic
1129034754 15:72642302-72642324 GCCTGCCAGCAGCTGGGGGAAGG - Intergenic
1129215128 15:74094914-74094936 GCCTGCCAGCAGCTGGGGGAAGG + Intergenic
1129261093 15:74367721-74367743 TTGAGCCTGCAGCAGGAGGAAGG - Exonic
1129709839 15:77815168-77815190 AGGTGCCAGCCGCTGGAGGAGGG - Intronic
1130045640 15:80442473-80442495 CTGTGCTAGAAGCTGAACGATGG - Intronic
1130288189 15:82572568-82572590 CTGTGCCTACAGTTGCAGGAGGG - Intronic
1131365339 15:91834390-91834412 ATTTCCCAGCAGCTAGAGGAAGG - Intergenic
1132269145 15:100507709-100507731 CAATGCCAGCAGATGGAGAATGG - Intronic
1132399786 15:101498300-101498322 CTCTGCCTGGAGCTGGGGGAGGG - Intronic
1132622848 16:875878-875900 GGGTCCCAGCTGCTGGAGGAGGG - Intronic
1132765974 16:1534366-1534388 GTGTGCCAGACGCTGGAGGATGG + Exonic
1133076060 16:3282350-3282372 CAGTGCCACCACCTGTAGGAAGG + Intronic
1133284186 16:4682990-4683012 CAGCGACAGAAGCTGGAGGAGGG - Intronic
1133476486 16:6126797-6126819 ATGAGCTAGGAGCTGGAGGAAGG + Intronic
1134098618 16:11436062-11436084 CTGGGCCAGGAGCTGGAGCCAGG - Intronic
1135109333 16:19678446-19678468 CAGTGCCAACAGCTGAAGTAAGG - Intronic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1137624937 16:49901576-49901598 GGGTGACAGAAGCTGGAGGAGGG - Intergenic
1137695455 16:50458989-50459011 TTGGGCCAGCAGCTGCAGGTAGG + Intergenic
1138540691 16:57685632-57685654 CGGAACCAGCATCTGGAGGAGGG - Exonic
1139768919 16:69256490-69256512 AAGTGCCAGGAGCTGAAGGAAGG - Intronic
1140097434 16:71886827-71886849 GGGTGCCAGGAGCTGGAGGAAGG - Intronic
1140388196 16:74561148-74561170 CTCTGACACCAGCAGGAGGAAGG - Intronic
1140782318 16:78307982-78308004 ATGTGGCAGCTGATGGAGGAAGG + Intronic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141777467 16:86133914-86133936 CTGTGCCATCACTTGGTGGAAGG - Intergenic
1142105009 16:88297942-88297964 CTGTGCTCCCAGCTTGAGGAAGG + Intergenic
1142135233 16:88448973-88448995 CTGTGGCTGCTGCTGTAGGAGGG + Intergenic
1142872262 17:2828596-2828618 CAGTGCCACCTGCTGGCGGACGG - Intronic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144334213 17:14254828-14254850 CGGTGACAGGAGCTGGTGGATGG - Intergenic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144730569 17:17523564-17523586 CAGTGCCAACAGCTGGTTGAGGG - Intronic
1144744217 17:17602663-17602685 CTGTGCCCCAAGCTGGAGGGCGG - Intergenic
1145005686 17:19336467-19336489 CTGTGCCAGAAGATGGGGCAGGG - Exonic
1145007742 17:19347071-19347093 CTGTTCCAGCAGCAGAAGGCCGG - Intronic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145231162 17:21174376-21174398 CTGTGGCTAAAGCTGGAGGAAGG - Intronic
1145351462 17:22088489-22088511 CTCTGGCACCAGCAGGAGGAGGG + Intergenic
1145782465 17:27572010-27572032 CTCTGCCAGCTGCTGGGGGAGGG + Intronic
1146903701 17:36604329-36604351 CTGTGCCAGCTGCTGCAGATGGG - Intronic
1147252443 17:39161135-39161157 CTATACCAGCAGCATGAGGAGGG - Intronic
1147874328 17:43610303-43610325 CTGTGCAAGCTGCTGGAGGACGG - Intergenic
1148106434 17:45121264-45121286 CTGTACCGGCTGCAGGAGGACGG - Exonic
1148163537 17:45465965-45465987 CTCTGCCTCCAGCTTGAGGAAGG + Intronic
1148463260 17:47850159-47850181 CTGCCCCAGGGGCTGGAGGATGG + Intronic
1148786547 17:50148796-50148818 CTCTGGCAGCCTCTGGAGGAAGG + Intronic
1149353374 17:55814477-55814499 CTGTGCCAGCAGCTGTGCCAAGG + Intronic
1150394764 17:64812617-64812639 CTCTGCCTCCAGCTTGAGGAAGG + Intergenic
1150453364 17:65287818-65287840 CTGTGCCACCACGTGGAGTATGG - Intergenic
1151485007 17:74393553-74393575 CTTTGACAGCAGATGGATGATGG - Intergenic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151654513 17:75489646-75489668 CCTTGCCTGGAGCTGGAGGAGGG - Exonic
1151679289 17:75615168-75615190 CTGTGCCTGGGGCTGGAGGGAGG + Intergenic
1151767358 17:76139313-76139335 CTGGGACAGCAGCTTTAGGAAGG + Intronic
1151821052 17:76497157-76497179 CTGTGCCAGCAGGTGGTGCAGGG - Intronic
1151960678 17:77403936-77403958 GGCTGCCAGCAGCTGGGGGAGGG - Intronic
1152039702 17:77894781-77894803 CTGCGCCAGGAGCAGGAGGGAGG + Intergenic
1152041328 17:77905839-77905861 CTGTGTGAGCAGCTAGTGGACGG - Intergenic
1152387686 17:79984902-79984924 CTGTGTCCGAAGCTGGAGGATGG - Intronic
1152604199 17:81280889-81280911 TTGTGCCGCCAGCTGGAGGCAGG + Intronic
1152612530 17:81322792-81322814 CGGTGGCAGCAGCTGGTGCAGGG - Intronic
1152930501 17:83107345-83107367 TTGTGCCAGCAGCCCCAGGACGG + Intergenic
1153801650 18:8676184-8676206 CTGAGCCAGTGGCTGGAGGGTGG + Intergenic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1154130955 18:11736735-11736757 CTGGGCCAGCCCCTGGAAGAAGG + Intronic
1154230446 18:12551919-12551941 CACTGCCAGGAGGTGGAGGAGGG - Intronic
1156653183 18:39251984-39252006 CAGTGGCAGCAGCTGTAGAAAGG - Intergenic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1157392420 18:47313936-47313958 CTGTGCCAGGGGCTGGATGATGG - Intergenic
1157941160 18:51930322-51930344 CTGTGAAAGCAGCTGGTGGGGGG + Intergenic
1158548204 18:58413770-58413792 CTGTGGCTGCAGGTGGAGGGAGG - Intergenic
1160388401 18:78512103-78512125 CGGTGACAGCAGCTGCAGGTGGG - Intergenic
1160779716 19:872421-872443 CCGGGCCCGCAGCTGTAGGAGGG - Intronic
1160947546 19:1650745-1650767 CTGTGCCATCTGCTGGGGGAGGG - Intronic
1161091041 19:2360201-2360223 CTGGGCCCGGGGCTGGAGGAAGG - Intergenic
1161102719 19:2429265-2429287 CTCTGCCAGCCGCTGGAAGTGGG - Exonic
1161166668 19:2791475-2791497 CTGGGCCAGGGGCTGGAGGGAGG + Intronic
1161378784 19:3953621-3953643 CTGGCCCAGCAGCTGCAGGGGGG + Intergenic
1161553820 19:4929210-4929232 GTGTCCCTGCAGATGGAGGACGG + Exonic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162141200 19:8586459-8586481 CCGGGCCAGCACCTGGAGAAAGG + Exonic
1162771023 19:12949365-12949387 CTGGCCCAGCTGCTGGAGCAGGG - Exonic
1163133091 19:15288747-15288769 CTGCCCCTGCAGATGGAGGAGGG + Intronic
1163205559 19:15800037-15800059 GTGTGCGAGCAGGTGGGGGAAGG - Intergenic
1163364734 19:16869614-16869636 CTGGTGCAGCAGCTGGTGGATGG - Exonic
1163683508 19:18697081-18697103 TGGTGCCAGCAGCTGGATGGGGG + Intronic
1163845575 19:19636643-19636665 CTTGGCCAGGGGCTGGAGGATGG + Intronic
1164581518 19:29438300-29438322 GTGTCCCAGGATCTGGAGGATGG - Intergenic
1164753027 19:30670116-30670138 AGGTGCCAGAAGCTGGCGGAAGG + Intronic
1164801282 19:31078934-31078956 GTGAGCGAGCAGCTGGATGAGGG - Intergenic
1165067289 19:33236642-33236664 CTGAGCTATCTGCTGGAGGAGGG + Intergenic
1166851604 19:45764063-45764085 CTCGGCCAGCAGCTGGTAGAAGG - Exonic
1166907819 19:46125578-46125600 CTGTGCCAGCAAGTGGAGGATGG - Intergenic
1166911148 19:46158858-46158880 TTGTGGCAGCAGGTGGGGGATGG + Intronic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
1168469590 19:56629548-56629570 CTGTGCCCACACATGGAGGAAGG - Intergenic
924975567 2:171343-171365 CTGTGCCAGACACTGGAGGCTGG - Intergenic
925306312 2:2849983-2850005 CTGCCCCAGCTGCTGGAGGGAGG - Intergenic
925551030 2:5074663-5074685 CTGTGTCAGTAGATGGAGGTTGG - Intergenic
926500877 2:13650763-13650785 CTCTGCCCTCTGCTGGAGGAGGG - Intergenic
926522841 2:13938157-13938179 ATCCACCAGCAGCTGGAGGAAGG - Intergenic
926581695 2:14636568-14636590 CTGGGGCCGCAGCTGGAGGGAGG - Exonic
927199331 2:20568645-20568667 CTGTGGCAGCAGCTCCTGGAAGG + Intronic
929266063 2:39920357-39920379 CAGTGGCAGCAGCTGTAGGCAGG + Intergenic
929375246 2:41278787-41278809 CATTGCCAGCAGCTGGAGTTGGG - Intergenic
929598916 2:43192956-43192978 CTGTGGGAGCAGGTGGAGGCTGG - Intergenic
930028021 2:47041303-47041325 CTGTGCCAGACGCTGGGGGAGGG + Intronic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
931071217 2:58652437-58652459 CTCTTCTAGCAGCTGGGGGATGG + Intergenic
931914027 2:66933462-66933484 CTGTGGCAGCTGATGGAAGAGGG - Intergenic
932892971 2:75611933-75611955 CTGTCCCAGCAGCAGTAGGGAGG - Intergenic
933185047 2:79269258-79269280 CTAAGCCAGCAGCTAAAGGAAGG + Intronic
933718004 2:85376343-85376365 CTGTGCCAGCAGGGGAAGGAGGG + Intronic
933778891 2:85787924-85787946 CTGGGCCAGTATGTGGAGGATGG + Exonic
934063377 2:88317783-88317805 CTTTTCCAGCATCTAGAGGATGG - Intergenic
934179966 2:89611552-89611574 CTATACCAGCAGCTGGCGCAGGG - Intergenic
934290262 2:91685813-91685835 CTATACCAGCAGCTGGCGCAGGG - Intergenic
935804790 2:106734776-106734798 TTGTCCCTGCAGCTGCAGGAGGG + Intergenic
936048466 2:109204587-109204609 CGCTGCCGGCACCTGGAGGATGG - Intronic
936308655 2:111366063-111366085 CTCTGCCTGCAGTTAGAGGAAGG + Intergenic
936398655 2:112149473-112149495 CTGAGCCAGCATATGGAGGGAGG - Intronic
936518700 2:113198653-113198675 CTGTGCAAGCAGCCACAGGAGGG + Intronic
936573998 2:113638374-113638396 CTGTGCCAGCAGTTACAGGGTGG + Intronic
937214916 2:120306389-120306411 AGGTGGCAGCAGGTGGAGGACGG - Intergenic
937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG + Intergenic
938294832 2:130171702-130171724 GTGGGCCAGCATCTGCAGGAAGG + Intronic
939008677 2:136819619-136819641 CTGAGCCACCACCTGGAGGAAGG + Intronic
941234748 2:162957128-162957150 TTGTAGCAGAAGCTGGAGGAGGG - Intergenic
941643956 2:168019631-168019653 CAGTGCCTGCAGTGGGAGGATGG + Intronic
943367785 2:186982053-186982075 CTGTGGCTGCAGCTGGAGCAAGG - Intergenic
945036630 2:205709092-205709114 CTAAGACAGCAGATGGAGGACGG + Intronic
945357918 2:208860666-208860688 CTGTGAAAGCAGCTGGATTAGGG + Intergenic
946180215 2:217944295-217944317 CTGGGCCAGTGGCTGAAGGAGGG - Intronic
947708992 2:232299463-232299485 CTGGGGCAGGAGCTGCAGGATGG - Intronic
948251865 2:236535987-236536009 CTGGGCCAGCAGAGGGAGGTGGG + Intergenic
948255296 2:236563960-236563982 CTGTGACAGCAGCTGGGGTGAGG + Intergenic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
949010774 2:241677138-241677160 CTGTCCCAGAAGCTTGAGAAGGG - Intronic
1168916333 20:1491291-1491313 CAGTGCCAGCAGCAGGAAGCAGG + Exonic
1168969976 20:1924377-1924399 CTGAATCAGCAGCTGGAAGAAGG - Intronic
1169340104 20:4790087-4790109 CTGTGCCCCCAGCTGGTGTATGG - Intronic
1170064780 20:12299327-12299349 CAGTGGCAGCAGCTGGGGGCTGG + Intergenic
1170498526 20:16950686-16950708 CTGTGCCACCAGCTGATGCAGGG - Intergenic
1170974301 20:21147991-21148013 GTGTGGCAGCAGATGAAGGAAGG + Intronic
1171060775 20:21957082-21957104 CAGTGTCAGCAGCTGTAGGAAGG + Intergenic
1172030032 20:31975241-31975263 CTCTGCCTGCAGGTGGAGGCGGG - Intronic
1172061034 20:32187709-32187731 CTCTGCAAGCAGGGGGAGGAGGG + Intergenic
1172132425 20:32664598-32664620 CTGTGGCTGCATCTAGAGGAGGG - Intergenic
1173971247 20:47154109-47154131 CTTTGCCAGCACCTGGATCATGG - Intronic
1174166444 20:48586910-48586932 CAGTACAAGCAGCTGGAAGACGG - Intergenic
1174172452 20:48625895-48625917 CTCTGCCAGCCGCCGGTGGATGG - Exonic
1174182413 20:48683141-48683163 TGCTGCCAGCAGCTGAAGGAGGG + Intronic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175195142 20:57238122-57238144 GGGTGCCTGGAGCTGGAGGAGGG - Intronic
1176367985 21:6045148-6045170 GTGTGGCAGCCACTGGAGGAGGG + Intergenic
1177679315 21:24344188-24344210 GTTTGCCAGGAGCTGGAAGAAGG - Intergenic
1178045758 21:28692976-28692998 TTTTGCCAGCAGCTGGAGGAGGG + Intergenic
1178785464 21:35649348-35649370 CTGAGTCACCACCTGGAGGAGGG + Intronic
1179176434 21:39011240-39011262 CTCTGCCAGCCACTGGAGAATGG + Intergenic
1179191318 21:39124496-39124518 CAGTGACAGAAGCTGGAGAAAGG + Intergenic
1179403065 21:41102321-41102343 CTGTGACAGCTGCTGGAAGGTGG + Intergenic
1179466648 21:41580272-41580294 CACAGCCAGCAGCTGGAGGAGGG + Intergenic
1179490975 21:41741420-41741442 CTTGGCCAGCAGCTTGACGATGG + Exonic
1179755534 21:43493394-43493416 GTGTGGCAGCCACTGGAGGAGGG - Intergenic
1180087914 21:45516319-45516341 CTGTGCCAGGTGGTGGAGGTCGG - Intronic
1180129415 21:45817505-45817527 CTGCGGCAGCAGCTGGAATATGG - Intronic
1180595060 22:16967672-16967694 ATGAGGCAGGAGCTGGAGGAAGG - Intronic
1180635360 22:17259107-17259129 GTGTGCCAGGAGCTGGGTGATGG + Intergenic
1180758533 22:18180780-18180802 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180768820 22:18364572-18364594 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180777492 22:18497823-18497845 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180810214 22:18755133-18755155 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180826695 22:18867796-18867818 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1181114099 22:20620581-20620603 GTGGGCCAGCATCTGCAGGAAGG + Intergenic
1181196356 22:21189385-21189407 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1181213171 22:21303739-21303761 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1181508794 22:23379656-23379678 CGGTGGGAGCAGCTGGAGGGAGG - Intergenic
1181523819 22:23466726-23466748 CTCTGCAAGCACCTGGATGAAGG + Intergenic
1181630508 22:24148741-24148763 CTGTTCCAGCAGAGGCAGGAAGG + Intronic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1182522143 22:30890750-30890772 CTCTGTCAGCCGCTGGAGCATGG - Exonic
1183391371 22:37547157-37547179 CTGGGCCAGCAGCTGTGGGGTGG - Intergenic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183987395 22:41577081-41577103 CTGGGCCACCAGGTGGAGCATGG + Exonic
1184022122 22:41827806-41827828 TGGTGCCAGCAGCTGGAGCTGGG + Intergenic
1184069349 22:42138422-42138444 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
1184227305 22:43136469-43136491 AGGAGGCAGCAGCTGGAGGACGG - Intronic
1184270804 22:43381857-43381879 CTGCGAGAGCTGCTGGAGGATGG - Intergenic
1184561863 22:45268408-45268430 CTGTGCGGGGACCTGGAGGAGGG - Intergenic
1185182941 22:49373437-49373459 CTGTGGCAGCAGCATGAGGCTGG - Intergenic
1185387768 22:50544194-50544216 CTGTGGCCGCAGTTGGAGGATGG - Intergenic
1203230442 22_KI270731v1_random:105456-105478 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1203276838 22_KI270734v1_random:93706-93728 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
950806057 3:15603961-15603983 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
952889625 3:38031325-38031347 CTGTGCCAGGGGCCAGAGGAGGG - Intergenic
952953627 3:38543364-38543386 CTGTGCCAGGTGCTGGGGCAGGG + Intergenic
953336447 3:42098360-42098382 CTTTTCCAGCACATGGAGGAAGG + Intronic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
954975728 3:54692429-54692451 CTGTGCCTGCAGAGGGAGCAGGG + Intronic
955975244 3:64474011-64474033 TTGTGCCTGTAGCTGGTGGATGG - Intergenic
957044560 3:75363797-75363819 CTACACCAGCACCTGGAGGACGG - Intergenic
957107259 3:75906724-75906746 CTGCGCCACCACCCGGAGGAGGG + Exonic
957374358 3:79336793-79336815 CTGTGAAAGCAGCTGGAAGGGGG + Intronic
959515886 3:107266687-107266709 CTGGGCCAGCAGCTGAATGATGG + Intergenic
960038643 3:113127133-113127155 CTGTGTCAGCACCTGGGGCATGG - Intergenic
960968960 3:123125507-123125529 CTGTGCCGGCAGCTGAGGGGAGG - Intronic
961925556 3:130475975-130475997 CTTTACCAACATCTGGAGGAAGG + Intronic
961932318 3:130547280-130547302 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
962350723 3:134653736-134653758 TTGTGTGAGCAGCTGGAGGGAGG - Intronic
962362747 3:134755540-134755562 TTGTGCCAGCTGCTTGAGGCTGG + Intronic
962746644 3:138401992-138402014 CTGTCCTGGCCGCTGGAGGAGGG - Intronic
962990303 3:140572001-140572023 CTGTGCCAGCAACAGGGGAAGGG + Exonic
963122698 3:141789538-141789560 CTGTCCCAGGAGCCAGAGGAAGG + Intronic
963583336 3:147154226-147154248 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
964349926 3:155792098-155792120 AGGTGCCTGGAGCTGGAGGAGGG - Intronic
967564432 3:190957445-190957467 CTGTGCCTACAGCTTGAGAAAGG + Intergenic
968108859 3:196025629-196025651 CTGTGCCAGACACTGGAGGCCGG - Intergenic
968532604 4:1101688-1101710 CTATGGCAGGAGCTGGAGGAGGG - Intronic
968582421 4:1401305-1401327 CTCTGCCAGCGGAGGGAGGAGGG + Intergenic
968664852 4:1815388-1815410 CAGTGCCACCAGCTGGGGGCGGG + Intronic
969338831 4:6527902-6527924 CTGTCCCAGGAGCTGGGGAAGGG + Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969594617 4:8142041-8142063 CTGGGCTTGCAGCTGGAGGGAGG - Intronic
969829315 4:9782078-9782100 CTATACCAGCAGCTGGCGCAGGG + Exonic
971082318 4:23227597-23227619 TTGGGCTAGCATCTGGAGGATGG + Intergenic
971604485 4:28639498-28639520 TTGTCCCATCAGCTGTAGGATGG + Intergenic
971744883 4:30566707-30566729 CTGTGAAAGCAGCTGGGAGAAGG + Intergenic
971996866 4:33975849-33975871 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
972128779 4:35802841-35802863 ATATGCCAGCAGCTGTAGCATGG - Intergenic
972247275 4:37258662-37258684 GAGTGTCAGCAGGTGGAGGAAGG + Intronic
972340259 4:38146537-38146559 CTTCCCCAGGAGCTGGAGGAGGG - Intergenic
973045386 4:45530596-45530618 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
975498201 4:75057503-75057525 CTGTCCCACCAGCTGGATAAAGG - Intergenic
976441724 4:85083515-85083537 CTGACCCTGCAGCTGAAGGAGGG + Intergenic
976513966 4:85943411-85943433 CTGTGCCCTCAGATGGTGGAAGG + Intronic
976745236 4:88396360-88396382 CTGTACCAGGTGCTGGAGAATGG + Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977781538 4:100986611-100986633 CTGTGGCAGCATCTGGCGGGGGG - Intergenic
978466256 4:109012617-109012639 CTGGGCCAGCAGCTGCAGAGGGG + Intronic
978514611 4:109557544-109557566 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
979252551 4:118580578-118580600 CTTTCCCAACAGCTGGATGAGGG + Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
979678613 4:123435590-123435612 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
979699970 4:123656443-123656465 CTGTGAAAGCAGCTGGAAGGAGG - Intergenic
979721514 4:123905502-123905524 CTGTGAAAGCAGCTGGGGGGGGG + Intergenic
980169090 4:129265334-129265356 GTGTGTCAGGAGCTGGAAGACGG - Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
984451553 4:179910234-179910256 CTGTGACACCAACTGAAGGATGG - Intergenic
985010165 4:185573913-185573935 CTGGGCCAGAGGCTGGAGGAAGG + Intergenic
985016653 4:185643206-185643228 CTGTGCTGGGACCTGGAGGATGG + Intronic
986103080 5:4631902-4631924 CTGTGTCAGGAGCTGGATGCTGG + Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986257752 5:6114759-6114781 CTGTACCAGCACCTGCAGGATGG + Intergenic
986398987 5:7361119-7361141 CTGTTCCAGAAGCTGGAAAAGGG + Intergenic
988858504 5:35252662-35252684 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
991431717 5:66554853-66554875 GGTTGCCAGGAGCTGGAGGAGGG - Intergenic
991473617 5:66996680-66996702 CTGGGCCTGAAGATGGAGGAAGG - Intronic
991963676 5:72070453-72070475 CTGTGCTTGCAGCTAGGGGAAGG - Intergenic
992262862 5:74988269-74988291 TAGTGCCTGGAGCTGGAGGAAGG - Intergenic
992750699 5:79857912-79857934 CTGTGCCAGCAGATACGGGAAGG + Intergenic
993761463 5:91801505-91801527 CTTTACCAGCAGCTTGAGAATGG - Intergenic
994590704 5:101768719-101768741 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
996747092 5:126854748-126854770 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
997512443 5:134462967-134462989 CTGAGCCATCTCCTGGAGGATGG - Intergenic
997606978 5:135182297-135182319 CTGGGCCAGCAGCTGGCTGTGGG - Intronic
997700180 5:135892052-135892074 CTGTGGCTGGAGCTGCAGGAGGG - Intergenic
998403921 5:141863085-141863107 CTGAGCCAGCAGTGGGAGGTGGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1000380446 5:160624286-160624308 CTGTGCCAGCAGCCCTAGGGAGG - Intronic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1002163497 5:177331202-177331224 ATGTGCAAGGGGCTGGAGGATGG - Intergenic
1002395548 5:178950243-178950265 CTGTGCCATGAGCTAGGGGAAGG + Intronic
1002639862 5:180625641-180625663 CTTGGCCAGCTGATGGAGGATGG + Intronic
1002840532 6:901459-901481 GTGTGCTAGGAGCTGGAGAAAGG - Intergenic
1002961364 6:1917844-1917866 GTGAGTCAGAAGCTGGAGGACGG + Intronic
1003690258 6:8346709-8346731 CTGTGAAAGCAGCTGGAAGGGGG + Intergenic
1004903280 6:20212672-20212694 CTGGCCCTGCAGCTGGAGGCGGG + Intergenic
1005127984 6:22470730-22470752 ATGTCCCAGAAGCAGGAGGAAGG + Intergenic
1006152302 6:31996046-31996068 CTGTCCCAGCAGCAGGCTGACGG + Exonic
1006158605 6:32028784-32028806 CTGTCCCAGCAGCAGGCTGACGG + Exonic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006414352 6:33894616-33894638 CCATGCCAGGAGCTGCAGGAGGG - Intergenic
1006786160 6:36668775-36668797 CTCTGACTGCAGCTGGAGGTAGG - Intergenic
1007018750 6:38497275-38497297 CTGTGACAGCAGTGGGAGGTGGG - Intronic
1007593592 6:43038082-43038104 CTGTCCTAGCAGCTGGTGGTTGG - Intronic
1007752516 6:44079131-44079153 CCGTGCCAGCAGGCAGAGGAGGG - Intergenic
1007829607 6:44628371-44628393 CTCTGACAGGGGCTGGAGGAAGG + Intergenic
1008007720 6:46429652-46429674 CTGTGCCAGGTGCTAGAGAATGG + Intronic
1010133643 6:72524300-72524322 CTGTGCCAGCAGGAGCAGGTGGG - Intergenic
1011170998 6:84504176-84504198 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1011933096 6:92738286-92738308 CTGTGAAAGCAGCTGGAATAGGG + Intergenic
1011935470 6:92771072-92771094 CTGTGCCAGCTCATGGTGGAAGG - Intergenic
1012988114 6:105896795-105896817 CTGTGAAAGCAACTGAAGGATGG - Intergenic
1013373464 6:109490904-109490926 TTGGGGCAGCAGCTGGAGGATGG + Intergenic
1013606942 6:111759225-111759247 CTGTGCCAGAAGCCAGAAGAAGG - Intronic
1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG + Intronic
1014169834 6:118266704-118266726 CTGCCCCAGCACCTGGAGGCAGG + Intronic
1014586299 6:123202092-123202114 CTGGGCCAGCAGCTGCAGAAGGG + Intergenic
1015764166 6:136698598-136698620 CTGTGACAGCAGCTTCATGAAGG - Exonic
1015969557 6:138730556-138730578 CTGTGAAAGCAACTGGAGGAAGG - Intergenic
1016059445 6:139614465-139614487 CTTTGCCAGCAGCTTTAGGTTGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1018186483 6:161269519-161269541 CAGTCCCAGCTGCTGGGGGAGGG + Intronic
1018388019 6:163322232-163322254 CTGGGCCTGCTGCTGGAGCAGGG - Intergenic
1018638346 6:165884404-165884426 CCTGGACAGCAGCTGGAGGAAGG + Intronic
1018706305 6:166465779-166465801 GTCTGTGAGCAGCTGGAGGACGG + Intronic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1019303344 7:320582-320604 CGTTGCCAGGAGCTGGGGGAGGG + Intergenic
1019612979 7:1946210-1946232 CTGGGCCTGCAGCTAGAGGTGGG - Intronic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1021543497 7:21786973-21786995 CAATGCCAGCAGCAGGTGGAAGG + Intronic
1021698178 7:23293602-23293624 CTGTGCCAGGCGCTGGACTAAGG - Intergenic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022316068 7:29246794-29246816 CTGTGCCCGCACATGGTGGAAGG + Intronic
1022471988 7:30687744-30687766 CTGTGCCACCTGCTGGAGGGAGG + Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023372467 7:39525517-39525539 GGTTGCCAGAAGCTGGAGGAAGG + Intergenic
1023879318 7:44309391-44309413 CTGAGCCAGCAGGAGCAGGAGGG + Intronic
1026796591 7:73369669-73369691 CTGTGCTTGCAGGTAGAGGATGG - Intergenic
1026806812 7:73434041-73434063 CTGTGGCAGCTGCTGGCGGCGGG + Exonic
1027192152 7:76002965-76002987 CTGTACCAGGGGCTGGAGCATGG - Intronic
1027220370 7:76210168-76210190 CTGTGCCATCAGCTGGAGATTGG - Intronic
1028963617 7:96777033-96777055 CAGTGGCAGTAGCTGGTGGATGG + Intergenic
1029479078 7:100802190-100802212 CTGGGGCAGGAGCTGGAGCAGGG - Intergenic
1031206929 7:118771847-118771869 ACTAGCCAGCAGCTGGAGGATGG - Intergenic
1032649033 7:133857729-133857751 GGGTGCCAGCATCTGGATGAGGG + Intronic
1033060058 7:138097526-138097548 CTGTCCCAGCAGGGGGAGCAGGG + Intronic
1033227754 7:139574678-139574700 TTGTCCCAGGACCTGGAGGAAGG - Intronic
1033336585 7:140458480-140458502 TATTGCCAGGAGCTGGAGGAAGG + Intronic
1033542831 7:142372897-142372919 CTGTGCCAGCAACTTGATGCAGG + Intergenic
1033619958 7:143053021-143053043 CTCTGCCAGCAGCTGCCAGAAGG + Exonic
1034265695 7:149779639-149779661 GTGTGCCATCAGCTGCTGGAAGG + Intergenic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035122439 7:156579615-156579637 CTGTGCCTGCAGGGTGAGGAAGG + Intergenic
1035879050 8:3223854-3223876 CTGTGACAGCTGCTTGTGGAGGG - Exonic
1036390188 8:8318460-8318482 ATGTGCCAGCTGCTGCAGGCCGG + Exonic
1036748659 8:11429127-11429149 GGGTGCCAGGGGCTGGAGGAGGG - Intronic
1036759336 8:11496568-11496590 CTGTGGCAGGGGCTGCAGGACGG + Intronic
1038214737 8:25551149-25551171 CTGTGACAGCAGTAGGAGGTGGG - Intergenic
1038296338 8:26293657-26293679 TTTTTCCAGGAGCTGGAGGAGGG + Exonic
1039228701 8:35419453-35419475 GGGTGCCAGCATCTGGATGAGGG + Intronic
1040003698 8:42600286-42600308 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1040416905 8:47203350-47203372 GTGTGCCCTCTGCTGGAGGAAGG - Intergenic
1041021650 8:53644085-53644107 CTGTCTCAGCAGGTGAAGGAAGG - Intergenic
1042057600 8:64782387-64782409 CTGTGCCCTCATGTGGAGGAAGG - Intronic
1042323876 8:67507895-67507917 CTGTGCCTGCAGTTTGAGGAAGG + Intronic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1042850677 8:73213158-73213180 ATTTGCCAGCTGCTGGAGTATGG - Intergenic
1043050234 8:75377031-75377053 GTGGGACAGGAGCTGGAGGAGGG - Intergenic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1044879789 8:96712222-96712244 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1046260321 8:111758975-111758997 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047775531 8:128067403-128067425 CTGTGCCAGCCGTGGAAGGAAGG - Intergenic
1047916518 8:129589738-129589760 CTTTGCCAGGTGCTGCAGGATGG - Intergenic
1048426588 8:134329156-134329178 CCGTGGTAGCTGCTGGAGGAGGG - Intergenic
1049309619 8:141926693-141926715 CTGTCCCAGGGGCTGGAGGCTGG + Intergenic
1049431338 8:142566703-142566725 TTCTGCCAGCAGCTGGAGTGAGG + Intergenic
1049612503 8:143562057-143562079 CTGTGCCAGCTGCTGCTGGAGGG + Exonic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049671358 8:143871488-143871510 CTGTACGAGCGGCTGGAGCATGG - Exonic
1052820562 9:33135208-33135230 CAGCGCCAGCAGCTGGACTATGG - Exonic
1052888785 9:33676805-33676827 CTGCGGCAGCAGCTGCTGGATGG + Intergenic
1053411820 9:37920727-37920749 CAGTGCCACCAGATGAAGGAAGG - Intronic
1053545318 9:39017540-39017562 CTGTGACAGCATCTAGGGGAGGG + Intergenic
1053809636 9:41839221-41839243 CTGTGGCAGCATCTAGGGGAGGG + Intergenic
1054620956 9:67348207-67348229 CTGTGGCAGCATCTAGGGGAGGG - Intergenic
1055268412 9:74526612-74526634 TTGTGCCAGAAACTTGAGGAAGG + Intronic
1055641043 9:78319345-78319367 CTGGGCTTGCAGCTGGAGGAGGG - Intronic
1056534182 9:87513566-87513588 CTAGACCAGCAGCTGGAGGTAGG + Intronic
1056879833 9:90380529-90380551 CTGTCCCATCAGCTGGGGGTGGG - Intergenic
1057141550 9:92729544-92729566 GTGTGACAGCAGCTGGGGGCCGG + Intronic
1057195358 9:93113375-93113397 CTGTGCCAGCAGCTGGATGTGGG - Intergenic
1057209783 9:93193461-93193483 CCGAGCCAGCAGGTGGAGGCTGG + Intronic
1058478161 9:105362364-105362386 CTGTGCCAGCTGCTGAAGATGGG + Intronic
1060277164 9:122191049-122191071 CTGGACCAGGACCTGGAGGAAGG - Intronic
1060283196 9:122227469-122227491 CTGGGCCATCACCTGGGGGAGGG + Exonic
1061209643 9:129183365-129183387 CTTTGCCAGATGCTGGAGCAGGG - Intergenic
1061254006 9:129443201-129443223 CTGTGCCCCCAGCTGGGAGAAGG + Intergenic
1061431739 9:130535651-130535673 CTGAGTGAGCAGCTGGAGGCGGG + Intergenic
1061783565 9:133009707-133009729 ATGTGGCAGCAGATGGATGAGGG + Intergenic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062028479 9:134351330-134351352 CTATGCCAGCAGCGGGCAGAGGG + Intronic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062623666 9:137433658-137433680 CTGAGGCAGCTGCTGGAAGAGGG + Intronic
1186222312 X:7363151-7363173 CTTTGCCAGAAGCTGGAGGGAGG + Intergenic
1187641516 X:21295835-21295857 CTTTGACTGCAGCAGGAGGATGG - Intergenic
1187826460 X:23336107-23336129 TTGTGCCATCAGCTTGAGGTGGG + Intronic
1187856065 X:23637116-23637138 CAGTGGCAGCAGCTGTAGGCAGG - Intergenic
1187946601 X:24432231-24432253 ATGTGACAGCAGTGGGAGGAAGG + Intergenic
1189123885 X:38425231-38425253 CCCTGTCAGCAGCTGGGGGATGG - Intronic
1189251714 X:39605406-39605428 CATTTCCAGCAGCTGCAGGAGGG + Intergenic
1190216524 X:48482585-48482607 CTGTCCCTGCAGCTAGAGGGCGG + Exonic
1190477239 X:50840198-50840220 CTGTGCCTGCAGAGAGAGGAAGG - Intergenic
1193007932 X:76642219-76642241 CTGTGGCTGCTGCTGGAGGTGGG + Intergenic
1193841986 X:86418155-86418177 CTGTGAAAGCAGCTGGGAGAAGG - Intronic
1195035137 X:100965433-100965455 CCATGCCAGGATCTGGAGGATGG - Intergenic
1195232357 X:102862490-102862512 CTGTGCTGGGATCTGGAGGAGGG - Intergenic
1195458210 X:105093454-105093476 GTGTGCTAGAAGCTGGAGAAGGG + Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1195990134 X:110674235-110674257 GTGTCCCAGCACCTGGAGGCAGG + Intronic
1198661638 X:138975267-138975289 CTGTGCCATCAACTGGAAAATGG - Intronic
1199457289 X:148043608-148043630 AGCTGCCAGGAGCTGGAGGAAGG + Intergenic
1199988323 X:152968583-152968605 CTGGGCCAGCAGCAGGATGGTGG + Intronic
1200167258 X:154045350-154045372 CTGTGGCAGCAGCTGGAGTCAGG - Intronic
1200184929 X:154175985-154176007 CAGCTCCAGGAGCTGGAGGAAGG - Intergenic
1200190582 X:154213123-154213145 CAGCTCCAGGAGCTGGAGGAAGG - Intergenic
1200196333 X:154250925-154250947 CAGCTCCAGGAGCTGGAGGAAGG - Intergenic
1200201988 X:154288043-154288065 CAGCTCCAGGAGCTGGAGGAAGG - Exonic
1200955319 Y:8938473-8938495 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
1201924715 Y:19271922-19271944 ATGTGCCAGCAGACAGAGGAAGG - Intergenic