ID: 1046934582

View in Genome Browser
Species Human (GRCh38)
Location 8:119874010-119874032
Sequence GGACTGCAGCGGGCACGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046934582_1046934593 28 Left 1046934582 8:119874010-119874032 CCAACGCGTGCCCGCTGCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1046934593 8:119874061-119874083 TTGCGACTCGCGTGGGGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 17
1046934582_1046934592 22 Left 1046934582 8:119874010-119874032 CCAACGCGTGCCCGCTGCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1046934592 8:119874055-119874077 CGTGGCTTGCGACTCGCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 10
1046934582_1046934591 21 Left 1046934582 8:119874010-119874032 CCAACGCGTGCCCGCTGCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1046934591 8:119874054-119874076 TCGTGGCTTGCGACTCGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 8
1046934582_1046934585 -3 Left 1046934582 8:119874010-119874032 CCAACGCGTGCCCGCTGCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1046934585 8:119874030-119874052 TCCTGCGCGCACGCGCTCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 81
1046934582_1046934590 20 Left 1046934582 8:119874010-119874032 CCAACGCGTGCCCGCTGCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1046934590 8:119874053-119874075 CTCGTGGCTTGCGACTCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 14
1046934582_1046934587 4 Left 1046934582 8:119874010-119874032 CCAACGCGTGCCCGCTGCAGTCC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1046934587 8:119874037-119874059 CGCACGCGCTCCCTGGCTCGTGG 0: 1
1: 0
2: 0
3: 11
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046934582 Original CRISPR GGACTGCAGCGGGCACGCGT TGG (reversed) Intronic
900166383 1:1245732-1245754 GGGCTCCAGCGGGGCCGCGTGGG + Intronic
900764419 1:4494501-4494523 GGGCTGCAGGGGGCCTGCGTGGG - Intergenic
901627850 1:10633808-10633830 GGCCTGCAATGGGCACGTGTTGG - Intergenic
903745519 1:25584249-25584271 GGACTGCTGCAGGCAAGCGCAGG - Intergenic
903963414 1:27071373-27071395 GGACTGCTGCAGGCACGGGAAGG - Intergenic
906525140 1:46489474-46489496 GGACTCCAGCTGCCAAGCGTCGG + Intergenic
917438368 1:175044079-175044101 GGACAGCAGCAGCCACGCGGTGG + Intergenic
918762739 1:188434712-188434734 GGACAGCAGCGAGCAGGGGTTGG + Intergenic
919513657 1:198495107-198495129 CGACTGCAGTGGGGAGGCGTAGG - Intergenic
1063593150 10:7410982-7411004 GGACCGGAGCGGGCGCGCGAGGG - Intronic
1070855947 10:79608135-79608157 GGACTGCAAGGGGCAAGCCTAGG - Intergenic
1073044999 10:100631901-100631923 GGCCCGCAGCGGGCACGGGCGGG - Intergenic
1075400118 10:122155001-122155023 CGACTGCTGCGGGCAGGCGTGGG + Intronic
1076461562 10:130650673-130650695 GGCCTCCAGCGGGCACCCGGAGG + Intergenic
1076793451 10:132788086-132788108 GGGCTGCCGAGGGAACGCGTGGG + Intergenic
1080072679 11:28108462-28108484 AGACTGCTGCGGGCAGGGGTTGG + Intronic
1083254689 11:61488915-61488937 GGGCTGCAGTGCGCACGGGTCGG + Intronic
1089075640 11:115736404-115736426 GAACTGCAGAGGGCACCTGTGGG + Intergenic
1096876238 12:54632556-54632578 GGAATGCAGCGGGCAGGGTTGGG + Intronic
1098342956 12:69470555-69470577 GGACGGCCGCGGGCCCGCGTCGG + Intronic
1112228771 13:97567114-97567136 GGACTGCAGCGGAGCCACGTGGG + Intergenic
1113505308 13:110812444-110812466 AGACTGCAGCGGGCCAGCGGGGG - Intergenic
1118947362 14:70399619-70399641 TGGCTGCAGCGGGGAGGCGTGGG - Intronic
1125535058 15:40437785-40437807 GGACTGCAGCGGGCAGTGGCGGG + Intergenic
1133350813 16:5098821-5098843 GGACCGAAGCGCGCACCCGTAGG - Intergenic
1138106120 16:54287859-54287881 GGCCTGCAGTGGGCACGCCCCGG + Intergenic
1139593757 16:67946869-67946891 GGACTGCAGCTGGCACGGAGGGG - Intronic
1139800531 16:69519060-69519082 TGAGTGCAGCAGGCACACGTCGG + Intergenic
1141208956 16:81958530-81958552 GGACTGCAGCAGGCAGCCGGTGG - Exonic
1142167797 16:88602142-88602164 TGCCTGCAGCGGGCACAGGTAGG - Intronic
1142710144 17:1718542-1718564 GGACTGCAGGTGGGACACGTTGG + Intronic
1142810929 17:2395194-2395216 GGGCTGCCGCGGGCAAGGGTGGG + Exonic
1143871723 17:9961500-9961522 GGGCTGCAGTGGGAACGCGGTGG - Intronic
1144775526 17:17782936-17782958 GGGCTGCCGCGGGGACGCGGCGG - Intronic
1147006281 17:37406734-37406756 GGACAGCAGCAGGCGCGCGGCGG + Intronic
1148023070 17:44566364-44566386 TGCCTGCTGCGGGCACGCATGGG + Intergenic
1149695910 17:58615920-58615942 GGACTGCAACTGGCACTAGTGGG + Intronic
1150737664 17:67754186-67754208 GGGCTGCAGCGGGCAGGCGGTGG + Intergenic
1166327478 19:42059987-42060009 GGATTGCAGCAGGCAGGAGTTGG - Intronic
1166862888 19:45819937-45819959 GGCCTGCAGCGTGCACGCCTGGG + Intronic
925452832 2:3985314-3985336 GGACTGTACCGGGCAGGGGTGGG + Intergenic
927030603 2:19117107-19117129 GGACAGCAGGGGGCAGGCGCAGG - Intergenic
940900188 2:159119703-159119725 GGACGGCAGCAGGCACTCTTAGG + Intronic
948223519 2:236291427-236291449 GGACTACAGGGGGCAGGGGTGGG + Intergenic
948805997 2:240453614-240453636 GGGCTGCGGCGGGCAGGCGAGGG - Intronic
1169195944 20:3682071-3682093 AGGCTGCACCGGGCACGGGTCGG - Exonic
1171444838 20:25195931-25195953 GGAGCGCAGCGCGCCCGCGTGGG - Intronic
1175777664 20:61663352-61663374 GGGCTGCTGCGGACAAGCGTTGG + Intronic
1175938213 20:62524981-62525003 GGAATGGAGCGGGGACGAGTGGG + Intergenic
1181306897 22:21922102-21922124 GGACTGCAGTGGGCTCGGATAGG - Exonic
1183702216 22:39457243-39457265 GGACCGCGGCGGGCGCGCGGGGG - Intergenic
1183946149 22:41326968-41326990 GGGCTGCAGTGGGCACGGGCAGG - Intronic
1184643615 22:45884794-45884816 GGACTGCAGTGGTCTCGCTTGGG + Intergenic
953705269 3:45225977-45225999 GGGCGGCAGCGGGCAGGCGGCGG + Exonic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
973718762 4:53702798-53702820 GGGCTGCAGCGAGCAGGGGTGGG - Intronic
977323801 4:95549679-95549701 GGAGTGCAGCGGGCGCGCCCCGG + Intergenic
994726306 5:103440462-103440484 GGACTGCAGGTGGCATGCATGGG + Intergenic
1003566883 6:7229772-7229794 GGACTGCAGCAGGTGGGCGTTGG - Exonic
1006753232 6:36392804-36392826 AGACTGCAGGGGGCAGGCGGGGG - Intronic
1007787518 6:44289675-44289697 AGACAGCAGTGGGCAAGCGTGGG + Intronic
1010794867 6:80106906-80106928 GGGCTGCAGCGGGACCGAGTGGG - Intronic
1018371412 6:163171809-163171831 GGACTGCAGCTGGCCCAAGTCGG + Intronic
1018610734 6:165645324-165645346 TGACTGCAGCAGGCAGGAGTAGG - Intronic
1020271717 7:6600497-6600519 GGAATGCAGGGGGCACGGCTGGG - Intronic
1029416220 7:100444838-100444860 GGGCTGGAGGGGGCACGTGTGGG - Intergenic
1040471156 8:47737196-47737218 AAACTGCAGCGGGCACCCGGCGG + Exonic
1044591504 8:93917488-93917510 GGACTGAAACGGGCACCCCTGGG + Intronic
1046934582 8:119874010-119874032 GGACTGCAGCGGGCACGCGTTGG - Intronic
1057198146 9:93126516-93126538 GGCCTTCAGCTGGGACGCGTTGG + Exonic
1059453703 9:114386894-114386916 GGGCTGCAGAGGGCACGGGGAGG - Intronic
1062407134 9:136402235-136402257 GGACAGCAGCAGCCACGCGGTGG + Exonic
1197215243 X:123860467-123860489 GGACTGCCGACGGCAGGCGTGGG + Intronic
1197749248 X:129953391-129953413 GGAATGCACCGGGCATGGGTGGG + Intergenic
1201065762 Y:10092764-10092786 GGGCTTCAGCTGGGACGCGTGGG + Intergenic