ID: 1046939848

View in Genome Browser
Species Human (GRCh38)
Location 8:119920546-119920568
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046939842_1046939848 28 Left 1046939842 8:119920495-119920517 CCTTGAAGATAAGTCAAATGGTT 0: 1
1: 0
2: 0
3: 18
4: 195
Right 1046939848 8:119920546-119920568 CATTCTAAGCAGAGGCATGGAGG No data
1046939841_1046939848 29 Left 1046939841 8:119920494-119920516 CCCTTGAAGATAAGTCAAATGGT 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1046939848 8:119920546-119920568 CATTCTAAGCAGAGGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr