ID: 1046943076

View in Genome Browser
Species Human (GRCh38)
Location 8:119950108-119950130
Sequence TCCTTTCGACAGATGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 470}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046943076_1046943079 -1 Left 1046943076 8:119950108-119950130 CCCTGCACCATCTGTCGAAAGGA 0: 1
1: 0
2: 0
3: 32
4: 470
Right 1046943079 8:119950130-119950152 ACGACCCTTTCCTCGTTATATGG No data
1046943076_1046943082 5 Left 1046943076 8:119950108-119950130 CCCTGCACCATCTGTCGAAAGGA 0: 1
1: 0
2: 0
3: 32
4: 470
Right 1046943082 8:119950136-119950158 CTTTCCTCGTTATATGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046943076 Original CRISPR TCCTTTCGACAGATGGTGCA GGG (reversed) Intronic
900456983 1:2780499-2780521 TCTTTTCAACAAATGTTGCAGGG - Intronic
901128537 1:6947043-6947065 TCTTTTCAACAAATGGTGCTGGG - Intronic
901923058 1:12549506-12549528 TCCCTTTGACAGATGCGGCAAGG + Intergenic
904539389 1:31222550-31222572 TTCTTTCTTCAGCTGGTGCAGGG + Intronic
904656389 1:32051233-32051255 TCTTTTCAACAAATGGTGCCGGG - Intronic
905136111 1:35801302-35801324 TCTTTTCAACAAATGGTGCTTGG + Intergenic
907227074 1:52957873-52957895 TCTTTTCAACAAATGGTGCAGGG - Intronic
907227086 1:52958004-52958026 TCTTTTCAACAAATGGTGCTAGG - Intronic
907252078 1:53146238-53146260 TCATTTTGACACATGGTGGAAGG - Intergenic
907949458 1:59167708-59167730 TCTTTTCAACAGATGGTGCTGGG + Intergenic
908058051 1:60313609-60313631 TCTTTTCAACAAATGGTGCTGGG + Intergenic
908254494 1:62291941-62291963 TCTTTTCAACAAATGGTGCTGGG - Intronic
908310019 1:62871609-62871631 TCTTTTCAACAAATGGTGCTTGG - Intergenic
908502925 1:64762640-64762662 TCTTTTCAACAGATGATGCTAGG + Intronic
908567588 1:65374014-65374036 TCTTTTCCATAGATGGTGCTGGG - Intronic
909061731 1:70886571-70886593 TGCTTTCGACAGATTGATCAAGG - Intronic
909619944 1:77656391-77656413 TTCTTAAGACAGATGGAGCATGG - Intronic
909667211 1:78148303-78148325 TCTTTTCAACAAATGGTGCTGGG + Intergenic
910242881 1:85106792-85106814 TCTTTTCAACAAATGGTGCTGGG + Intronic
912169656 1:107083316-107083338 TCTTTTCAACAAATGGTGCTGGG - Intergenic
912662567 1:111545853-111545875 TCTTTTCAACAAATGGTGCTGGG - Intronic
916910762 1:169343341-169343363 TCTTTTCAACAGATGGTGCTAGG - Intronic
918077785 1:181183478-181183500 TCCTTTCGCCAGATGTGCCAGGG - Intergenic
919442187 1:197649627-197649649 TCTTTTCAACAAATGGTGCTGGG + Intronic
919816165 1:201441323-201441345 TCATTTCAACAAATGGTGCTGGG + Intergenic
920772105 1:208897814-208897836 TCCTTTCAACAAATAGTGCTGGG - Intergenic
921032786 1:211348708-211348730 TCTTTTCAACAAATGGTGCTGGG - Intronic
921033161 1:211351695-211351717 TCTTTTCAACAAATGGTGCTGGG - Intronic
921038927 1:211410623-211410645 TTTTTTCAACAGATGGTGCTGGG + Intergenic
921836768 1:219786463-219786485 TCTTTTCAACAAATGGTGCTGGG + Intronic
921909796 1:220535744-220535766 TCTTTTCAACAAATGGTGCTGGG - Intronic
922017036 1:221658962-221658984 TCTTTTCAACATATGGTGCTGGG - Intergenic
923201267 1:231714353-231714375 TTCTTTCAACTGATGGTGCTGGG + Intronic
923289885 1:232534297-232534319 TCTTTTCAACAAATGGTGCTGGG + Intronic
923342056 1:233015982-233016004 TCCATTCCTCAGATGGTTCATGG - Intronic
1063012050 10:2032315-2032337 TCTTTTCAACAAATGGTGCCAGG - Intergenic
1064187849 10:13178474-13178496 TCTCTTCAACAAATGGTGCAGGG - Intronic
1064700450 10:18013700-18013722 TCCTTTCAAGAGATGGTGCTGGG - Intronic
1064775194 10:18769263-18769285 TCTTTTCAACAAATGATGCAGGG - Intergenic
1065091669 10:22241258-22241280 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1065447451 10:25817925-25817947 TCATTTCTACAGATTGGGCAAGG + Intergenic
1065499760 10:26367970-26367992 TCCTTACCACAGAAGGTGAAGGG + Intergenic
1066538072 10:36412904-36412926 TACTTTAAACAGATGGTGCATGG - Intergenic
1066644964 10:37597221-37597243 TACTTTTAATAGATGGTGCATGG - Intergenic
1067398373 10:45945759-45945781 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1067762774 10:49060896-49060918 TCCTTTTGACAGACAGTGCTGGG - Intronic
1067813458 10:49450235-49450257 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1067866686 10:49914844-49914866 TCTTTTCAACAAATGGTGCTGGG + Intronic
1068387102 10:56344687-56344709 TCTTTTCAACAGATGGTACTAGG + Intergenic
1068532459 10:58204989-58205011 TCCTATCAACAAATGGTGCTGGG + Intronic
1068550372 10:58401344-58401366 TCTTTTCAACAAATGGTGCTAGG - Intergenic
1068559752 10:58500617-58500639 TCTTTTCAACAAATGGTGCTAGG + Intergenic
1068932086 10:62601799-62601821 TCTTTTCAACAGATGATGCTGGG - Intronic
1069327400 10:67248353-67248375 TCTTTTCAACAAATGGTGCTAGG + Intronic
1069378073 10:67814268-67814290 TCTTTTCAACAAATGGTGCTAGG + Intronic
1070974237 10:80592602-80592624 TCTTTTCAACAAATGGTGCTTGG - Intronic
1071535191 10:86422803-86422825 TCTTTTCAACAAATGGTGCCTGG + Intergenic
1072380502 10:94864287-94864309 CCTTTTCAACAGATGGTGCTGGG - Intergenic
1072552048 10:96486709-96486731 TGCTCTCTACAGATGGTTCAAGG - Intronic
1072953819 10:99871541-99871563 TCTTTTGCACAGATGGTGCCAGG - Intergenic
1074142980 10:110692002-110692024 TCTTTTCAACAAATGGTGCTGGG - Intronic
1075819004 10:125289526-125289548 TGCTTTTCACATATGGTGCAAGG - Intergenic
1076007928 10:126962958-126962980 TCTTTTCCACAAATGGTGCTGGG - Intronic
1076260260 10:129059489-129059511 TCCTTCTGCCAGCTGGTGCAGGG + Intergenic
1077427176 11:2487106-2487128 TCTTTTCAACAAATGGTGCTGGG - Intronic
1077449537 11:2629563-2629585 TCTTTTCAACAAATGGTGCCAGG - Intronic
1077625270 11:3765901-3765923 TCTTTTCAACATATGGTGCTGGG - Intronic
1078029110 11:7730857-7730879 TCCTTTCAATAAATGGTGCTGGG - Intergenic
1078076254 11:8164104-8164126 TCTTTTCAACAAATGGTGCTGGG + Intronic
1078692916 11:13599780-13599802 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1078967893 11:16368517-16368539 TCTTTTCAACAAATGGTGCTTGG + Intronic
1080260443 11:30343816-30343838 TCCTTTAGACAAATGTAGCATGG + Intergenic
1081571834 11:44296218-44296240 TCTTTTCTACAAATGGTGCTGGG + Intronic
1083080069 11:60082580-60082602 TCTTTTCTACAAATGGTGCCGGG - Intergenic
1084786292 11:71443629-71443651 TCCTTTCCAGACCTGGTGCAAGG + Intronic
1084794076 11:71492503-71492525 TCCTTTCAGCAAATGGTGCTGGG - Intronic
1086430819 11:86734970-86734992 TTATTTCGACAAATGGTGAAAGG + Intergenic
1088642898 11:111890452-111890474 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1089548313 11:119248375-119248397 TCTTTTCAACAAATGGTGCTGGG + Intronic
1091102351 11:132886768-132886790 TCATTTCCAAAGATGCTGCAGGG - Intronic
1091455388 12:603633-603655 TCTTTTCAACAAATGGTGCTGGG - Intronic
1091569712 12:1674115-1674137 TCTTTTCAACAAATGGTGCTTGG - Intergenic
1092363625 12:7859029-7859051 TCTTTTCAACAAATGGTGAAGGG - Intronic
1092656872 12:10695089-10695111 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1092774933 12:11935359-11935381 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1092824110 12:12381434-12381456 TCTTTTCAACATATGGTACAGGG - Intronic
1093408812 12:18840483-18840505 CCCTTTCAACAAATGGTGCTGGG - Intergenic
1093540377 12:20276147-20276169 TCTTTTCAACAAATGGTGCTAGG - Intergenic
1093940314 12:25047086-25047108 TCTCTTCAACAAATGGTGCAGGG + Intronic
1094422605 12:30287307-30287329 TATTTTCAACAGATGGTGCTGGG - Intergenic
1094622940 12:32097597-32097619 GCCTTTCGACAAATGATGCTGGG + Intergenic
1094645062 12:32315185-32315207 TCTTTTCAACAAATGGTGCTGGG - Intronic
1095117855 12:38377342-38377364 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1095394931 12:41751071-41751093 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1095416957 12:41987801-41987823 TCCTTGCTAAAGATGGTGCCAGG + Intergenic
1095531645 12:43193516-43193538 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1096012218 12:48228876-48228898 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1096131516 12:49162704-49162726 TCTTTTCTACAAATGGTGCTGGG + Intergenic
1096168194 12:49443311-49443333 TCTTTTCAACAAATGGTGCTGGG - Intronic
1096279279 12:50237849-50237871 TCTTTTCAACAAATGGTGCTAGG + Intronic
1096569095 12:52509474-52509496 TCTTTTCAATAAATGGTGCAAGG - Intergenic
1097303961 12:58048508-58048530 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1098508785 12:71286481-71286503 TCTTTTCAACAAATGGTACAGGG - Intronic
1099243886 12:80171427-80171449 TCTTTTCAACAAATGGTGCTAGG - Intergenic
1099554085 12:84088094-84088116 TATTTTCAACAGATGGTGCTGGG - Intergenic
1100650008 12:96575810-96575832 TCTTTTCTACAAATGGTGCTAGG - Intronic
1101644030 12:106611851-106611873 TCTTTTCAACAAATGGTGCTGGG - Intronic
1102140064 12:110607305-110607327 TCCCTTCAACAAATGGTGCTGGG + Intergenic
1102267943 12:111504601-111504623 TCTTTTTAACAGATGGTGCTGGG + Intronic
1102949094 12:117016864-117016886 TCTTTTCAACAGATGGTGCCAGG - Intronic
1103209310 12:119154858-119154880 TCCTTTCCACACTTGGTTCAAGG - Intronic
1103279596 12:119745537-119745559 TCCTTCCGACAGATGGAAAATGG + Intronic
1105203598 13:18200682-18200704 TCCTCTCAATAGATGGTGCTGGG - Intergenic
1105266572 13:18823814-18823836 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1105515290 13:21084169-21084191 TCATTTCAACAAATGGTGCCAGG + Intergenic
1105730242 13:23207226-23207248 TCTGTTCAACAGATGGTGCTGGG + Intronic
1105788592 13:23774159-23774181 TCCTTTCGAAGAATGGTGCTGGG - Intronic
1106346253 13:28881969-28881991 TCTTTTCAACAAATGGTGCTAGG + Intronic
1107297584 13:38927809-38927831 TCTTTTCAACAGATGATGCTGGG + Intergenic
1107766607 13:43741971-43741993 TCTTTTCAACAAATGGTGCCAGG - Intronic
1107811636 13:44206354-44206376 TGCTTTGGACAGATGGTGGGTGG + Intergenic
1107871499 13:44750618-44750640 TACTTTCCACAGCTGGTGAAGGG + Intergenic
1108288604 13:48934277-48934299 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1109744056 13:66597488-66597510 TCCCTTCAACAAATGGTGCTGGG + Intronic
1111561094 13:89947931-89947953 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1111747912 13:92292898-92292920 TCTTTTCAACAAATGGTGCTGGG - Intronic
1111757454 13:92416480-92416502 TCTTTTCAACAAATGGTGCTGGG + Intronic
1113210942 13:107980051-107980073 TCTGTTCAACAGATGGTGCAGGG - Intergenic
1113803936 13:113102637-113102659 TCCTTGTGACGGAGGGTGCAGGG - Intergenic
1114066830 14:19067385-19067407 TCCTCTCAATAGATGGTGCCAGG - Intergenic
1114095435 14:19332642-19332664 TCCTCTCAATAGATGGTGCCAGG + Intergenic
1114180308 14:20361188-20361210 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1114382541 14:22222897-22222919 TCTTTTCGACAAGTGGTGCTGGG + Intergenic
1114477322 14:23005805-23005827 TCCTTTAGACAGACAGTTCAGGG + Intronic
1114998922 14:28397382-28397404 TCCTTTCAATAAATGGTGCTGGG - Intergenic
1116200130 14:41783038-41783060 TCCTTTCTCGAGATGGTACAAGG + Intronic
1116751093 14:48884911-48884933 TATTTTCAACAGATGGTGCTAGG - Intergenic
1117782391 14:59247123-59247145 TCTCTTCGACAAATGGTGCTGGG - Intronic
1118928890 14:70221079-70221101 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1119056247 14:71423544-71423566 TCCTTTCAACAAATGGTGCTGGG - Intronic
1119523825 14:75306473-75306495 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1121247014 14:92468664-92468686 TCTTTTCAACAAATGGTGCTAGG + Intronic
1121316879 14:92966853-92966875 TCGTTTCAACAAATGGTGCTTGG + Intronic
1122095612 14:99368933-99368955 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1122432366 14:101662105-101662127 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1202831955 14_GL000009v2_random:44267-44289 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1124421144 15:29523794-29523816 TCTTTTCAACAAATGGTGCTGGG + Intronic
1124427703 15:29576240-29576262 TCTCTTCAACAGATGGTGCTGGG + Intergenic
1124435214 15:29642920-29642942 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1125217941 15:37299095-37299117 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1125377427 15:39045479-39045501 CCCTTTCAACAAATGGTGCTGGG + Intergenic
1126770857 15:52054433-52054455 TCTTTTCAACAAATGGTGCCAGG - Intronic
1127050557 15:55079151-55079173 CCCTTTCAACAAATGGTGCTGGG + Intergenic
1127929703 15:63584981-63585003 TCTTTTCAAAAGATGGTGCTGGG - Intronic
1128445191 15:67753102-67753124 TCTTTTCAACAAATGGTGCTGGG + Intronic
1128531812 15:68457463-68457485 TCATTTCAATAGATGGTGCTAGG + Intergenic
1128913335 15:71536863-71536885 TCTTTTCCACAAATGGTGCCAGG - Intronic
1129785640 15:78308441-78308463 TCCTTTCTTCAGCTGGTCCATGG + Intergenic
1132033801 15:98462382-98462404 TCTTTTCAACAAATGGTGCTGGG + Intronic
1132144778 15:99423152-99423174 TCCTTTCAATAAATGGTGCTGGG - Intergenic
1132259735 15:100412298-100412320 TCTTTTCGACAAATGGTGCTGGG - Intronic
1132465082 16:73648-73670 TCCTCTGGATAGAGGGTGCAGGG + Intronic
1134268711 16:12715028-12715050 TCTTTTCAACAAATGGTGCAGGG - Intronic
1135774823 16:25248007-25248029 TCTTTTCAACAAATGGTGCTCGG + Intronic
1136566990 16:31076550-31076572 TCCTTGCCACAGGTGGTACAGGG - Exonic
1138844621 16:60550452-60550474 TCTCTTCAACAAATGGTGCAGGG - Intergenic
1139271350 16:65686326-65686348 TCTAGTGGACAGATGGTGCAAGG - Intergenic
1141508335 16:84495764-84495786 TCCTTTCAACAGGTGGGACATGG + Exonic
1141916966 16:87105050-87105072 TCTTTTCAACAAATGGTGCTGGG - Intronic
1142764626 17:2058239-2058261 TTCTTCCCGCAGATGGTGCATGG - Exonic
1144097251 17:11911266-11911288 TCTTTTCAACAAATGGAGCAGGG - Intronic
1144158010 17:12526788-12526810 TCTGTTCAACAGATGGTGCTGGG - Intergenic
1144799601 17:17916502-17916524 TCTTTTCAACAAATGGTGCTGGG - Intronic
1146456799 17:33015058-33015080 TCCGTTCCACAGAGGCTGCAGGG + Intronic
1146960444 17:36970838-36970860 TCTTTTCAACAAATGGTGCTGGG + Intronic
1148018919 17:44540835-44540857 TCCTTTTGATAGATGTTCCAGGG - Intergenic
1148893651 17:50826807-50826829 TCTTTTCAACAGACGGTGCTGGG - Intergenic
1149556075 17:57574428-57574450 TCCTTCAGAAGGATGGTGCATGG + Intronic
1150027722 17:61695223-61695245 TCTTTTCAACAGATGGTGTTGGG - Intronic
1150037925 17:61824569-61824591 TTTTTTCAACAAATGGTGCAGGG + Intronic
1151654426 17:75489254-75489276 TTCTTTCTGCAGATGGTGCCTGG + Exonic
1152920513 17:83064284-83064306 CCCTGGGGACAGATGGTGCAGGG - Intergenic
1154129674 18:11725988-11726010 TCTTTTCAAAAGATGGTGCTGGG - Intronic
1154421842 18:14237659-14237681 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1156646120 18:39164124-39164146 TCCTATGGAAAGATGGTACAAGG + Intergenic
1157601980 18:48898884-48898906 TCTTTTCAACAGATGGTGTTGGG + Intergenic
1157720419 18:49919107-49919129 TCCTTTCAACAAATGGTCCTGGG + Intronic
1158062954 18:53368673-53368695 TCTTTTCAACAAATGGTGCTGGG - Intronic
1158444029 18:57503099-57503121 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1158949640 18:62481785-62481807 TCTTTTCAACAAATGGTGCAGGG + Intergenic
1160252544 18:77215844-77215866 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1160267118 18:77348393-77348415 TCCTTTCAACAAATGGTGCTGGG - Intergenic
1160627620 18:80223028-80223050 TCTTTTCAACAAATGGTGCTGGG + Intronic
1163510363 19:17731340-17731362 TCTTTTCAACAAATGGTGCTGGG - Intronic
1164125264 19:22309134-22309156 TCTTTTCAACAAATGGTGCTGGG - Intronic
1164976642 19:32578234-32578256 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1165054893 19:33169003-33169025 TCTTTTCAACAAATGGTGCTAGG + Intronic
1165870239 19:38966818-38966840 TCTTTTCAACAAATGGTGCTGGG + Intronic
1167407515 19:49323126-49323148 TCTTTTCAACAAATGGTGCTGGG + Intronic
1168200062 19:54808432-54808454 TCATTTCAATAAATGGTGCAGGG - Intronic
1202640728 1_KI270706v1_random:83485-83507 TCTTTTCAACAAATGGTGCTGGG + Intergenic
928228505 2:29475980-29476002 TGCTTCGGACAGATGGGGCAGGG + Intronic
928260318 2:29760936-29760958 TCCTTGGGACAGAAGGGGCAGGG - Intronic
928809113 2:35200053-35200075 TCCTTTTGACAAATGGTTCCTGG - Intergenic
928851396 2:35751411-35751433 TCTTTTCAACAAATGGTGCTGGG + Intergenic
929647454 2:43641726-43641748 TCTTTTCAACAGATGATGCTGGG - Intronic
930505807 2:52281729-52281751 TGTTTTTGACAGATGGGGCAGGG + Intergenic
930852467 2:55975426-55975448 TCCTTTCCACACATGTTCCATGG + Intergenic
930875833 2:56214619-56214641 TCCTTTCAACAAATGGTACTGGG - Intronic
931993278 2:67812466-67812488 CCTTTTCAACAGATGGTGCTGGG + Intergenic
932826592 2:74947206-74947228 TCCTTTCAACAAATTGTGCTAGG - Intergenic
933231724 2:79815493-79815515 TCTTTTCAACAAATGGTGCTGGG - Intronic
933855456 2:86409580-86409602 TCTTTTCAACAAATGGTGCTGGG + Intergenic
933872841 2:86586399-86586421 TCTTTTCAACAAATGGTGCTGGG + Intronic
934496285 2:94803458-94803480 TCTTTTCAACAAATGGTGCTGGG + Intergenic
934536091 2:95134823-95134845 TCTTTTCAACAAATGGTGCTGGG - Intronic
934885261 2:98018970-98018992 TCTTTTCAACAGATAGTGCTGGG - Intergenic
935633141 2:105228453-105228475 TCTTTTCAACAAATGGTGCTGGG + Intergenic
936176324 2:110223777-110223799 TCTTTTCAACAAATGGTGCTGGG - Intergenic
936242901 2:110803428-110803450 TCTTTTTGACAAATGGTGCTGGG + Intronic
936852727 2:116920479-116920501 TCCATTCCACAAATGGTGGAAGG - Intergenic
937581219 2:123490857-123490879 TCTTTTCAACAAATGGTGCTGGG + Intergenic
937899653 2:127009249-127009271 TCTTTTCAACAAATGGTGCTGGG - Intergenic
938068882 2:128297284-128297306 TCTTTTCAACAAATGGTGCTGGG + Intronic
938484227 2:131687476-131687498 TCCTCTCAATAGATGGTGCCAGG - Intergenic
938844291 2:135192790-135192812 TCTTTTCAACAAATGGTGCTGGG + Intronic
939610591 2:144305334-144305356 TCTTTTCAACAGATGGTGCTGGG - Intronic
940197384 2:151110671-151110693 TCTTTTCAACAAATTGTGCAGGG - Intergenic
941631242 2:167887001-167887023 TCTTTTCAACAAATGGTGCTGGG - Intergenic
941947834 2:171119730-171119752 TCTTTTCAACAAATGGTGCAGGG + Intronic
942031933 2:171971527-171971549 TCCGTTCAACAAATGGTGCCAGG - Intronic
942056322 2:172186887-172186909 TCTTTTCAACAAATGGTGCTGGG - Intergenic
942180524 2:173376378-173376400 TCTTTTCAACAAATGGTGCTGGG - Intergenic
942803183 2:179899368-179899390 TACTTTAGACAGAGGGTTCAGGG - Intergenic
943793137 2:191958164-191958186 TCCTTTAAACAGCAGGTGCATGG - Intronic
944154605 2:196596194-196596216 TCCTTTCTACAGATGTGCCAAGG + Intergenic
944830653 2:203530996-203531018 TCCTTTCAACAAATGGTGCTGGG + Intronic
945075557 2:206035497-206035519 CCCTTTCAACAAATGGTGCTGGG + Intronic
945738155 2:213627083-213627105 TGCCATCCACAGATGGTGCATGG - Intronic
946283837 2:218687482-218687504 TCTTTTCCACAAATGGTGCCAGG - Intronic
947683228 2:232055876-232055898 TCTTTTCAACAAGTGGTGCAAGG + Intronic
948092887 2:235310040-235310062 TCTTTTCAACAAATGGTGCAGGG + Intergenic
1168801559 20:646577-646599 TCCTTTAGACCAATGGTTCAGGG - Intergenic
1170054333 20:12182843-12182865 CCCTTTCAACAAATGGTGCTAGG - Intergenic
1170752187 20:19159986-19160008 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1170964143 20:21051475-21051497 TCTTTTCAGCAAATGGTGCAGGG - Intergenic
1171789456 20:29506882-29506904 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1171858083 20:30367558-30367580 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1172378342 20:34465130-34465152 TCTTTTCAACAAATGGTGCTTGG - Intronic
1173901147 20:46589757-46589779 GCCTTTCAACAAATGGTGCTAGG + Intronic
1174963322 20:55182880-55182902 TCCTTTCAGCAGATAGTTCAAGG - Intergenic
1176714371 21:10337395-10337417 TCCTCTCAATAGATGGTGCTGGG + Intergenic
1176851639 21:13922301-13922323 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1177291306 21:19116605-19116627 TGTTTTCAACAAATGGTGCAGGG - Intergenic
1177672816 21:24255568-24255590 CCTTTTTGACAAATGGTGCAGGG + Intergenic
1178059861 21:28840124-28840146 TTCTTTCAACAAATGGTGCTGGG + Intergenic
1178346902 21:31837170-31837192 TCTCTTCAACAGATGGTGCTGGG - Intergenic
1179024684 21:37670096-37670118 TCTTTTCAACAAATGGTGCTGGG - Intronic
1179806493 21:43841401-43841423 TCTTTTCAACAGATGGTGCTGGG - Intergenic
1180361216 22:11898377-11898399 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1180409604 22:12592747-12592769 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1180485313 22:15789969-15789991 TCCTCTCAATAGATGGTGCCAGG - Intergenic
1180580685 22:16833420-16833442 GCCTTTCAACAAATGGTGCTAGG - Intergenic
1181515184 22:23406356-23406378 TCTTTTCGACAACTGGTGCTGGG + Intergenic
1184953980 22:47869464-47869486 TCTTTTCAACAGATTGTGCTGGG + Intergenic
949988408 3:9557723-9557745 TCCTTCCCACAGATGTTGTAAGG + Intergenic
950165662 3:10795836-10795858 TCTTTTCAACAAATGGTGCTGGG + Intergenic
950319604 3:12038135-12038157 TCTTTTCAACAAATGGTGCTGGG - Intronic
951434926 3:22650859-22650881 CCTTTTCAACAAATGGTGCAGGG + Intergenic
951967530 3:28403802-28403824 TCTTTTCAACAAATGGTGCTGGG + Intronic
953255270 3:41284503-41284525 CCCTTTCAACAAATGGTGCTGGG + Intronic
953511608 3:43546534-43546556 TCTTTTCAACAAATGGTGCTGGG + Intronic
953633199 3:44637693-44637715 TCTTTTCAACAAATGGTGCCTGG - Intronic
955283995 3:57621239-57621261 ACCTTTCAACAAATGGTGCTGGG + Intergenic
955304100 3:57812304-57812326 TCTTTTCAACAAATGGTGCTAGG - Intronic
955682487 3:61516613-61516635 TCTTTTCAACAAATGGTGCTGGG + Intergenic
955827029 3:62958434-62958456 TCTTTTCAACAAATGGTGCTGGG - Intergenic
956024327 3:64966316-64966338 TCTCTTCAACAGATGGTGCTAGG - Intergenic
956306875 3:67835619-67835641 TCCTTTCGAGAGACGGTTCTTGG + Intergenic
957375368 3:79349723-79349745 TCTTTTCAACAAATGGTTCAGGG + Intronic
957972072 3:87395105-87395127 TCTTTTCAACAAATGGTGCTGGG + Intergenic
958460698 3:94390951-94390973 TCTATTCGACAAATGGTGCTGGG + Intergenic
958490212 3:94763125-94763147 TCTTTTCAACAAATGGTGCTGGG - Intergenic
958507587 3:95000024-95000046 TCTTTTCGACAAATGATGCTGGG + Intergenic
958789822 3:98638960-98638982 CCCATTCGACAAATGGTGCTGGG - Intergenic
959032173 3:101311950-101311972 CCTTTTCGACAAATGGTGCTTGG + Intronic
959039929 3:101409694-101409716 TCTTTTCAACAAATGGTGCTGGG + Intronic
960077824 3:113508041-113508063 TCTTTTCAACAGATGGTGCTGGG + Intronic
960547341 3:118931131-118931153 TCTTTTCAACAAATGGTGCTGGG + Intronic
960559792 3:119071556-119071578 TCTTTTCAACAAATGGTGCTTGG - Intronic
960646902 3:119895640-119895662 TCTTTTTGACAAATGGTGCTTGG - Intronic
960981693 3:123234520-123234542 TCTTTTTGACAAATGGTGCTAGG + Intronic
961113769 3:124310671-124310693 TCTTTTCAACAAATGGTGCTGGG + Intronic
961468372 3:127095811-127095833 CCCTTTCAACAAATGGTGCTGGG - Intergenic
962487208 3:135855760-135855782 TCTTTTCAACAAATGGTGCTGGG + Intergenic
963166375 3:142208523-142208545 TTTTTTCAACAGATGGTGCTGGG - Intronic
963242340 3:143019514-143019536 TCTTTTCAACAAATGGTGCTTGG - Intronic
964248519 3:154683305-154683327 TCCCTTCAACAAATGGTGCTGGG - Intergenic
964725611 3:159811516-159811538 TCTTTTCAACAGATGGTGCTGGG - Intronic
965586516 3:170323500-170323522 TCCTTTCGGGAGATGGAGGAGGG + Intergenic
965989297 3:174797189-174797211 TCTTTTCAATAGATGGTGCTGGG - Intronic
966009544 3:175057543-175057565 TCTGTTCCCCAGATGGTGCAGGG - Intronic
966706997 3:182927129-182927151 TCTTGTCAACAAATGGTGCAGGG + Intergenic
967349686 3:188499359-188499381 TCTTTTCAACAAATGGTGCTGGG - Intronic
1202737824 3_GL000221v1_random:23902-23924 TCTTTTCAACAAATGGTGCTGGG - Intergenic
969607071 4:8207507-8207529 TCCTTGCGACAGAGGCTGCCAGG + Intronic
970223960 4:13837907-13837929 TCCCTTCAACAAATGGTGCTGGG + Intergenic
970411381 4:15811502-15811524 ACTTTTCAACAAATGGTGCAGGG - Intronic
970526611 4:16938912-16938934 TCCTTTAGAGAGATAGTTCAGGG + Intergenic
970640575 4:18061167-18061189 TCATTTCAACAAATGGTGCTGGG - Intergenic
970684213 4:18547512-18547534 TCTTTTCAATAGATGGTGCTGGG - Intergenic
971430412 4:26559881-26559903 TCTTTTCGACAAATGATGCTGGG - Intergenic
971491833 4:27220634-27220656 TCTCTCCAACAGATGGTGCAGGG - Intergenic
971812854 4:31449965-31449987 TCTTTTCAACAAATGGTGCTAGG - Intergenic
972269614 4:37498142-37498164 CCCTTTCAACAAATGGTGCTTGG - Intronic
972624501 4:40783273-40783295 TCTTTTCAACAAATGGTGCTGGG + Intronic
973384246 4:49494017-49494039 TCTTTTCAACAAATGGTGCTGGG + Intergenic
975128614 4:70809899-70809921 TCCTTTCAACAAATGGTGTTGGG + Intergenic
975472825 4:74790587-74790609 TCCTTTGGGCAGATGGAGAAGGG - Intronic
975615276 4:76239957-76239979 TCTTTTTGACAAATGGTGCTGGG - Intronic
976650712 4:87431174-87431196 TCTTTTCAACAAATGGTGCTAGG - Intronic
977590320 4:98818872-98818894 TCTTTTCAATAGATGGTGCTGGG + Intergenic
978122480 4:105097036-105097058 TCTTTTCAACAAATGGTGCTGGG + Intergenic
978878836 4:113675529-113675551 TCCTTTTGACAGAAATTGCACGG - Intronic
979381693 4:120013927-120013949 TCTTTTCAACAAATGGTGCTGGG - Intergenic
979590073 4:122468435-122468457 TCTTTTCAACAGATGGTGCTTGG + Intergenic
980416045 4:132489879-132489901 TCTTTTCAACAAATGGTGCAGGG + Intergenic
980580445 4:134743622-134743644 TCTTTTCAACAAATGGTGCTAGG + Intergenic
982956355 4:161773103-161773125 TCTATTCAACAGATGGTGCTGGG + Intronic
984724364 4:183006364-183006386 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1202768097 4_GL000008v2_random:169340-169362 TCTTTTCAACAAATGGTGCTGGG + Intergenic
985700129 5:1366126-1366148 TCTTTTCAACAAATGGTGCTGGG + Intergenic
985906064 5:2837793-2837815 TTCTTTCAACAAATGGTGCTGGG + Intergenic
986746541 5:10749953-10749975 TCCTTTCTGCAGATGAAGCAGGG - Intronic
986898889 5:12407123-12407145 TCTTTTCGATAAATGGTGCTGGG - Intergenic
987070533 5:14333317-14333339 TCCTGTGGACACATGTTGCAGGG + Intronic
987986114 5:25148389-25148411 TCCCTTCAATAAATGGTGCAGGG + Intergenic
989079228 5:37599551-37599573 TCCTTTCAACAAATGATGCTGGG + Intronic
989390203 5:40892418-40892440 TCTTTTCAACAGATGGTGCTGGG + Intergenic
990015151 5:51052350-51052372 TCCTTTGTACATATGGTGAATGG + Intergenic
990180928 5:53159654-53159676 TCTTTTCGACGTATGGTGCTAGG + Intergenic
990275311 5:54189552-54189574 TCTTTTCAACAGATGGTGCTAGG + Intronic
992695886 5:79286678-79286700 TTCTTTCGATAAATGGTACATGG + Intronic
992741192 5:79774975-79774997 TCCTTTAGCCACAGGGTGCAAGG - Intronic
992840342 5:80683919-80683941 TCTTTTCAACAAATGGTGCTGGG - Intronic
993097860 5:83501522-83501544 TCTTTTCAACAAATGGTGCTGGG - Intronic
993489781 5:88532945-88532967 TCTTTTCAACAAATGGTGCTAGG + Intergenic
995729228 5:115219357-115219379 TCTTTTCAACAAATGGTGCTAGG + Intronic
995951763 5:117722762-117722784 TCTTTTCTACAAATGGTGCAGGG - Intergenic
996362056 5:122659877-122659899 TCATTTCGATTGCTGGTGCAAGG - Intergenic
996684223 5:126262867-126262889 TCCTTTCAATAAATGGTACAGGG + Intergenic
997620823 5:135292392-135292414 TCTTTTCCACAAATGGTGCTGGG - Intronic
997895596 5:137713439-137713461 TCTTTTCAACAAATGGTGCTGGG + Intronic
998110610 5:139499580-139499602 TCTTTCCGACAAATGGTGCTGGG - Intergenic
998580390 5:143368148-143368170 TCTTTTCAACAAATGGTGCTGGG + Intronic
998917536 5:147031804-147031826 TCTTTTCCACAAATGGTGCTGGG + Intronic
999050091 5:148513373-148513395 TCCTTTCAATACATGCTGCAGGG - Intronic
999918730 5:156293551-156293573 TCATTTCAACAAATGGTGCTGGG - Intronic
1001830334 5:174781550-174781572 TCTTTTCAAAAGATGGTGCTGGG - Intergenic
1002969691 6:2001796-2001818 TCTTTTCAACAAATGGTGCACGG + Intronic
1003451276 6:6235112-6235134 TCATTTTTACATATGGTGCAAGG - Intronic
1003834403 6:10054003-10054025 TCTTTTCAACAAATGGTGCTGGG + Intronic
1005841377 6:29746410-29746432 TCTTTTCAACAAATGGTGCTAGG + Intergenic
1005949350 6:30619945-30619967 TGATCTCGACAGATGGGGCAGGG - Exonic
1006587348 6:35124747-35124769 TCTTTTCAACAAATGGTGCTGGG + Intronic
1008121295 6:47620293-47620315 CCCTTTCAACAAATGGTGCTGGG - Intronic
1008943958 6:57076714-57076736 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1008973166 6:57393894-57393916 CCTTTTCAACAAATGGTGCAGGG - Intronic
1009162072 6:60295433-60295455 CCTTTTCAACAAATGGTGCAGGG - Intergenic
1009266734 6:61565076-61565098 TCTTTTCAACAAATGGTGCTAGG + Intergenic
1009974400 6:70657560-70657582 TACTTTCATCAAATGGTGCATGG + Intergenic
1011789329 6:90881038-90881060 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1012207997 6:96484979-96485001 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1012620258 6:101335690-101335712 TCTCTTCGACAAATGGTGCTGGG - Intergenic
1012923149 6:105240488-105240510 CCTTTTCAACAGATGGTGCTGGG + Intergenic
1013182001 6:107725525-107725547 TCTTTTCAACAAATGGTGCTGGG + Intronic
1014229488 6:118887387-118887409 TCTTTTCAACAGATGCTGCTGGG + Intronic
1014518717 6:122411660-122411682 TCTTTTCAACAAATGGTGCTGGG - Intronic
1014945953 6:127497854-127497876 TCTTTTCGACAAACGGTGCTGGG + Intronic
1016113366 6:140253757-140253779 TCCTTTCAATAGATGGGGGAAGG - Intergenic
1016127449 6:140422736-140422758 TCTCTTCGATAGATGGTGCTGGG - Intergenic
1016929281 6:149387343-149387365 TCTTTTCAACAAATGGTGCTGGG - Intronic
1019464394 7:1179263-1179285 TCTTTTCAACACATGGTGCTGGG - Intergenic
1019948723 7:4352431-4352453 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1020726647 7:11823185-11823207 TCCTTTCAATAAATGGTGCTGGG - Intronic
1022013968 7:26332803-26332825 TCCTTTCAACAAATGGTGCTGGG - Intronic
1022550139 7:31230468-31230490 CCCTTTCAACAAATGGTGCTGGG - Intergenic
1023018758 7:35990866-35990888 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1023242798 7:38166474-38166496 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1023420427 7:39973816-39973838 TCTTTTCAACAAATGGTGCTGGG - Intronic
1023647521 7:42333877-42333899 TCCTTTCAACAAATAGTGCTGGG + Intergenic
1023979196 7:45057047-45057069 TCTTTTCAACAAATGGTGCTGGG - Intronic
1023985835 7:45095149-45095171 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1024098162 7:46002727-46002749 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1024304879 7:47920800-47920822 TCTTTTCAACAAATGGTGCTGGG + Intronic
1024475919 7:49810778-49810800 TCTTTTCAACAAATGGTGCAGGG + Intronic
1027191482 7:75998652-75998674 TCATTTCAACAAATGGTGCTAGG + Intronic
1027589762 7:80103187-80103209 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1027925018 7:84449055-84449077 TATTTTCAACAGATGGTGCCAGG + Intronic
1028193876 7:87882240-87882262 TCTTTTCAACAGCTGGTGCTGGG + Intronic
1028283440 7:88963425-88963447 TACTTTCAACAGATGGTGCTAGG + Intronic
1028583523 7:92430879-92430901 TCGTTTTGACAAATGGTGCTGGG + Intergenic
1028695748 7:93709606-93709628 TCCTTTCCACAAATGGTACTGGG - Intronic
1030067728 7:105673325-105673347 TTCTTTCTAAAAATGGTGCAGGG - Intronic
1030142154 7:106316014-106316036 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1030184533 7:106748256-106748278 TCTTTTCAACAAATGGTGCGGGG + Intergenic
1030238087 7:107289244-107289266 TCTTTTAGACAAATGGTGCTGGG - Intronic
1030286267 7:107830033-107830055 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1030414532 7:109225662-109225684 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1030713460 7:112781660-112781682 TCTTTTCAACAAATGGTGCTGGG + Intronic
1031459051 7:122022977-122022999 TCCTTCCAACAGATGGTGCTAGG + Intronic
1031542967 7:123017576-123017598 TCTTTTCAACAGATGCTGCTGGG - Intergenic
1032060553 7:128720696-128720718 TCTTTTCAACAAATGGTGCTAGG - Intronic
1032099802 7:128964850-128964872 TCTTTTCAACAAATGGTGCTGGG + Intronic
1033351204 7:140563585-140563607 GCCTTTCTACAGAGGGAGCAAGG + Intronic
1034209496 7:149350592-149350614 TCGTTTCAACAGATGTTGCTGGG + Intergenic
1035594584 8:845891-845913 TCTTTTCCACAGATGGTACCAGG - Intergenic
1036617627 8:10400767-10400789 ACTTTTCAACAGATGGTGCTGGG + Intronic
1037697692 8:21240622-21240644 TCCCTTCCATAGATGGTGCTGGG - Intergenic
1039398878 8:37251046-37251068 TCTCTTCAACAGATGGTGCTAGG + Intergenic
1039597238 8:38801447-38801469 TCTTTTTGACAAATGGTGCTGGG - Intronic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1040100539 8:43498082-43498104 TCTTTTCCACAAATGGTGCTGGG - Intergenic
1040100589 8:43498979-43499001 TCTTTTAGACAAATGGTGCTGGG - Intergenic
1040429838 8:47328589-47328611 TCTTTTCAACAAATGGTGCTGGG - Intronic
1040670721 8:49686940-49686962 CCCTTTCTACAAATGGTGCTGGG - Intergenic
1040866903 8:52056593-52056615 GCCTTTCCCCAGATGTTGCAGGG - Intergenic
1041222620 8:55666651-55666673 TCTTTTCAACAAATGGTGCTAGG + Intergenic
1041577536 8:59416963-59416985 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1042663693 8:71182875-71182897 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1043261314 8:78202182-78202204 CCCTTTCAACAAATGGTGCTGGG + Intergenic
1043471097 8:80563587-80563609 TCTTTTCAACAAATGGTGCTAGG - Intergenic
1043875691 8:85483900-85483922 TCTTTTCTACAAATGGTGCTGGG - Intergenic
1044363264 8:91313218-91313240 TCTTTTCAACAAATGGTGCAGGG - Intronic
1045537411 8:103044462-103044484 TCTTTTCAACAAATGGTGCTGGG - Intronic
1046498033 8:115039740-115039762 TTTTTTCAACAAATGGTGCAGGG - Intergenic
1046640465 8:116724215-116724237 TCTCTTCAACAGATGGTGCTAGG + Intronic
1046943076 8:119950108-119950130 TCCTTTCGACAGATGGTGCAGGG - Intronic
1047087875 8:121539401-121539423 TCCTTTCAATAAATGGTGCTGGG - Intergenic
1048562072 8:135550457-135550479 TCTTTTCAACATATGGTGCTAGG - Intronic
1050974305 9:11916993-11917015 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1051054194 9:12964494-12964516 TTCTATCAACAGATAGTGCAGGG + Intergenic
1053518544 9:38753448-38753470 TCCATTGGACAGATGGGGAAAGG + Intergenic
1053724330 9:40982770-40982792 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1054341640 9:63869230-63869252 TCTTTTCAACAAATGGTTCAGGG - Intergenic
1054361853 9:64129877-64129899 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1054860625 9:69949201-69949223 TCCTTTGGCCTGAAGGTGCATGG + Intergenic
1055238424 9:74153424-74153446 CCTTTTCGACAAATGGTGCTGGG - Intergenic
1055911263 9:81354973-81354995 TCCTTCCAACAAATGGTGCTGGG + Intergenic
1057242640 9:93425398-93425420 TCTTTTCAACAAATGGTGCTAGG - Intergenic
1057609638 9:96529308-96529330 TCTTTTCAACAAATGGTGCTGGG - Intronic
1058992163 9:110264846-110264868 TCTTTTCAACAGATGATGCTAGG + Intergenic
1059075032 9:111183900-111183922 TCTTTTCAACACATGGTGCTGGG - Intergenic
1059397363 9:114045449-114045471 TCTTTTCAACAAATGGTGCTGGG - Intronic
1060460172 9:123845276-123845298 ACTTTTCAACAGAAGGTGCAGGG + Intronic
1061806720 9:133141046-133141068 CCCATTTGACAGATGGGGCAAGG + Intronic
1062223694 9:135436247-135436269 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1203692503 Un_GL000214v1:58246-58268 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1203706551 Un_KI270742v1:54346-54368 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1203556686 Un_KI270744v1:5138-5160 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1203643792 Un_KI270751v1:45945-45967 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1187099186 X:16174623-16174645 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1187228820 X:17401149-17401171 TCTTTTCAACAAATGGTGCTGGG + Intronic
1187375673 X:18751421-18751443 TCTCTTCAACAGATGGTGCTGGG - Intronic
1187451886 X:19404776-19404798 TCTTTTCAACAAATGGTGCTAGG + Intronic
1188260939 X:28023186-28023208 TCTTTTCAACAGATGATGCTAGG - Intergenic
1189218787 X:39352171-39352193 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1189878701 X:45466419-45466441 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1190001582 X:46693491-46693513 TCTTTTCAACAAATGGTGCTGGG + Intronic
1190704351 X:53014051-53014073 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1190723970 X:53174549-53174571 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1190724937 X:53183066-53183088 TCTCTTCAACAGATGGTGCTGGG - Intergenic
1191148584 X:57195834-57195856 TGCTTTCAACAAATGGTGCTGGG - Intergenic
1192384995 X:70658966-70658988 TCTTTTCAACAAATGGTGCTGGG + Intronic
1192387270 X:70683962-70683984 TCCTTTCAGCAAATGGTGCTAGG + Intronic
1193423378 X:81311629-81311651 CCCTTTCAACAAATGGTGCTGGG - Intergenic
1195019650 X:100813963-100813985 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1195173881 X:102296295-102296317 TTCTTCCGTCAGATGGAGCATGG + Intergenic
1195184984 X:102390798-102390820 TTCTTCCGTCAGATGGAGCATGG - Intronic
1195253149 X:103067728-103067750 TCTTTTCAACAAATGGTGCTTGG - Intergenic
1195266630 X:103187376-103187398 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1195530003 X:105943267-105943289 TCTTTTCAACAAATGGTGCTGGG - Intronic
1195653164 X:107308493-107308515 TCTTTTCAACAAATGGTGCCAGG + Intergenic
1195717927 X:107836093-107836115 TCTTTTCAACAAATGGTGCTTGG - Intronic
1195800696 X:108706065-108706087 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1195837903 X:109139672-109139694 TCTTTTCAACAAATGGTACAGGG + Intergenic
1195917457 X:109949655-109949677 TCTTTTCAATAGATGGTGCTGGG + Intergenic
1195935596 X:110123144-110123166 TCTTTTCAACAAATGGTGCTGGG - Intronic
1196239309 X:113322964-113322986 TCTTTTTGACAAATGGTGCTGGG + Intergenic
1196362564 X:114881572-114881594 TCTTTTCAACAAATGGTGCTAGG - Intronic
1196702984 X:118691978-118692000 TCTTTTCAACAAATGGTGCAGGG - Intergenic
1196708085 X:118733852-118733874 TCTTTTCAACAAATGGTGCTGGG - Intronic
1196716505 X:118816424-118816446 TCTGTTCAACAAATGGTGCAGGG - Intergenic
1197485622 X:127046982-127047004 TCTTTTCAACAAATGATGCAGGG - Intergenic
1197711161 X:129669389-129669411 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1197739937 X:129882902-129882924 TCTTTTCAACAAATGGTGCTAGG - Intergenic
1197861213 X:130972707-130972729 TCCTTTCAACAAATGGTGCTGGG - Intergenic
1198195918 X:134361804-134361826 TGTTTTCAACAAATGGTGCAAGG + Intergenic
1198313339 X:135441665-135441687 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1199229640 X:145422449-145422471 TCCTTTCCACATATAATGCAGGG + Intergenic
1199618091 X:149674720-149674742 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1199624551 X:149728529-149728551 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1199749193 X:150798443-150798465 TCTTTTCAACAAATGGTGCTGGG + Intronic