ID: 1046943178

View in Genome Browser
Species Human (GRCh38)
Location 8:119950998-119951020
Sequence GGAAAGTCAAGGCTGCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046943171_1046943178 19 Left 1046943171 8:119950956-119950978 CCAGCACTTTGGGAGGCCAAGGT 0: 27245
1: 121406
2: 220571
3: 206232
4: 124988
Right 1046943178 8:119950998-119951020 GGAAAGTCAAGGCTGCAGTGAGG No data
1046943168_1046943178 28 Left 1046943168 8:119950947-119950969 CCTATAACTCCAGCACTTTGGGA 0: 26
1: 2207
2: 46313
3: 337368
4: 243787
Right 1046943178 8:119950998-119951020 GGAAAGTCAAGGCTGCAGTGAGG No data
1046943174_1046943178 3 Left 1046943174 8:119950972-119950994 CCAAGGTGGTAGGATTGCTTGAG 0: 19
1: 2443
2: 7693
3: 19475
4: 40921
Right 1046943178 8:119950998-119951020 GGAAAGTCAAGGCTGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046943178 Original CRISPR GGAAAGTCAAGGCTGCAGTG AGG Intronic
No off target data available for this crispr