ID: 1046943388

View in Genome Browser
Species Human (GRCh38)
Location 8:119952846-119952868
Sequence TCTGATATGCAGGCTGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046943384_1046943388 23 Left 1046943384 8:119952800-119952822 CCATGAGTAAGGAACCAAGGTGA 0: 1
1: 0
2: 2
3: 17
4: 116
Right 1046943388 8:119952846-119952868 TCTGATATGCAGGCTGGTGAAGG No data
1046943385_1046943388 9 Left 1046943385 8:119952814-119952836 CCAAGGTGAGATTGAGTATGTTC 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1046943388 8:119952846-119952868 TCTGATATGCAGGCTGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046943388 Original CRISPR TCTGATATGCAGGCTGGTGA AGG Intronic
No off target data available for this crispr