ID: 1046943794

View in Genome Browser
Species Human (GRCh38)
Location 8:119956149-119956171
Sequence CAAGCTACTCCCAAACTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 294}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046943794 Original CRISPR CAAGCTACTCCCAAACTTGG TGG (reversed) Intronic
901408488 1:9066443-9066465 CAGGCTGGTCCCAAACTTGTGGG + Intronic
902998263 1:20244681-20244703 CAAACAACTCCAAAACTAGGTGG - Intergenic
903766521 1:25738474-25738496 CAAATTACTCCAAAACTTGGGGG + Intronic
904753707 1:32756432-32756454 CAAGCTACTCTCAAACTCCTGGG - Intronic
905064871 1:35171986-35172008 CTAGCTACTCCCAAACTCTGGGG + Intergenic
906212758 1:44021245-44021267 CCAGCTGCTCCCAGGCTTGGAGG + Intronic
906220777 1:44077416-44077438 CAAATTACTCCAAAACTCGGTGG + Intergenic
906387017 1:45378683-45378705 CAAGCTACCCCAAAACTTAGTGG - Intronic
906523792 1:46482487-46482509 CAAATTACCCCCAAACTTAGTGG - Intergenic
908252733 1:62277851-62277873 CAAGCCATCCCAAAACTTGGTGG - Intronic
909660323 1:78075243-78075265 CAGGCTAGTCTCAAACTTGTGGG - Intronic
909674564 1:78225017-78225039 CAAATTACCCCAAAACTTGGTGG - Intergenic
912151856 1:106869175-106869197 CAAACTACTCAAAAACTTTGTGG - Intergenic
913684146 1:121215509-121215531 AGGGCTACTCCCAAACTGGGTGG - Intronic
914035985 1:144003124-144003146 AGGGCTACTCCCAAACTGGGTGG - Intergenic
914153473 1:145064821-145064843 AGGGCTACTCCCAAACTGGGTGG + Intronic
914493769 1:148173566-148173588 CAAATTACTCCAAAACTTAGTGG - Intergenic
914856573 1:151356160-151356182 CAAACTACCCCAAAACTTAGTGG - Intergenic
915967032 1:160318149-160318171 CAAGCTACTCTTAAATTTGAGGG + Intronic
918130537 1:181624029-181624051 CAAGCTGCTCCCACTCATGGTGG + Intronic
918285587 1:183051550-183051572 CAAGCTACTCCAAAGCTCAGTGG - Intronic
920287675 1:204892323-204892345 CAAGCCACCCCAAAACTTAGTGG + Intronic
920471450 1:206234001-206234023 AGGGCTACTCCCAAACTGGGTGG - Intronic
920595738 1:207268145-207268167 CAATTTACTCCCAAACTGGATGG - Intergenic
921914743 1:220594710-220594732 CAAGCTACGAAAAAACTTGGAGG + Intronic
921957927 1:221003370-221003392 CAAGCAACCCCTAAACTTAGTGG + Intergenic
923222989 1:231913373-231913395 CTAGCTAGTCCCAAAATTTGAGG - Intronic
924101247 1:240604745-240604767 CAAGCTGGTCCCGAACTCGGGGG - Intronic
924287164 1:242499712-242499734 CAAACCACCCCAAAACTTGGTGG + Intronic
1062997496 10:1880751-1880773 CAAACCACTTCCAAACTTCGTGG - Intergenic
1063502173 10:6564739-6564761 CAAACTGCTCCCAAACTTAGTGG - Intronic
1063620199 10:7640258-7640280 CAGGCTAATCTCAAACTTCGGGG - Intronic
1063978284 10:11434102-11434124 CAAATTACCCCCAAACTTAGTGG - Intergenic
1064636420 10:17372733-17372755 CAAATTACTCCAAAACTTAGTGG + Intronic
1064879228 10:20031549-20031571 CAAACAACTCCAAAACTTGATGG + Intronic
1065019060 10:21487689-21487711 CAAGCCACTCCAAAGCTTAGTGG + Intergenic
1065327391 10:24560892-24560914 CCATCTACTCCCAAATCTGGGGG - Intergenic
1066203160 10:33161154-33161176 CAAACTATCCCCAAACTTAGTGG + Intergenic
1067311049 10:45113940-45113962 CAAGCTCCTCCCAGGCGTGGTGG - Intergenic
1067551507 10:47239675-47239697 CATTCTACTCCAAAACTTAGTGG - Intergenic
1067694501 10:48524725-48524747 CAGGCTACCCTCAAACCTGGCGG + Intronic
1068015356 10:51509584-51509606 CAAGCTGGTCTCAAACTTTGGGG + Intronic
1068881949 10:62059263-62059285 CAAGCTGCTCAAAAACTGGGAGG + Exonic
1069614112 10:69795647-69795669 CAAACTGCTCCAAAACTTAGTGG - Intergenic
1071239246 10:83685961-83685983 CAAACCACTCCCAAACTTAATGG + Intergenic
1071371391 10:84955185-84955207 CAAGCCACTCCAAAACTCAGTGG + Intergenic
1072158429 10:92744674-92744696 CAAATTACCCCAAAACTTGGTGG + Intergenic
1072207091 10:93214395-93214417 CCAGCTTCTCCCAATCTTTGGGG + Intergenic
1072255465 10:93616325-93616347 CTACATACTCCCAACCTTGGAGG + Intronic
1073484167 10:103806164-103806186 CCAGGTTCTCCCAAACTTCGGGG + Intronic
1073578115 10:104641685-104641707 CCAGCTCCTGCCAAGCTTGGCGG + Exonic
1074267400 10:111918244-111918266 CAAGCTACTCTCAAACTCCTGGG - Intergenic
1075354732 10:121761150-121761172 CAAGCTGCTCCCACCCATGGTGG - Intronic
1075518408 10:123128317-123128339 CAAATTACTCCAAAACTTAGTGG + Intergenic
1075594510 10:123718651-123718673 CAAGCTACCCCAAAACTCAGTGG + Intronic
1075947457 10:126448499-126448521 CAAGCTAAGCCCAAAGTTGGTGG + Intronic
1076867969 10:133178536-133178558 CAAGCCACTCCCAGCCTGGGTGG + Intronic
1077081401 11:726136-726158 CAAGCTACCCCCAAGCTTCCCGG + Exonic
1077960478 11:7072089-7072111 CAAACTATCCCAAAACTTGGTGG + Intergenic
1078195821 11:9135862-9135884 CAAGCTGCTTCCACACATGGTGG - Intronic
1078787271 11:14507100-14507122 TAAGCTACCCCAAAACTTAGGGG - Intronic
1081408873 11:42731559-42731581 CTAATTACTCCCAAACTTAGTGG - Intergenic
1081770058 11:45644673-45644695 CAAGTCACTCCAAAACTTAGTGG + Intergenic
1083817972 11:65148058-65148080 CAAGCCACTCTCAAACCTAGAGG - Intergenic
1086065451 11:82738893-82738915 CAAATTACTCCAAAACTTAGTGG + Intergenic
1086401745 11:86466463-86466485 CAAGCTGCTCCCAAGCCTGTAGG - Intronic
1087094253 11:94305127-94305149 CAGGCTCCTGCCAGACTTGGGGG + Intergenic
1088274615 11:108071964-108071986 CAAGCTGGTCTCAAACTTCGGGG - Intronic
1088680466 11:112237247-112237269 CAAATTACTCCCAAACATAGTGG + Intronic
1088947081 11:114525230-114525252 AAACCTACTCCCAAAGTTTGAGG - Intronic
1089082545 11:115788916-115788938 CAAAGTACTCCAAAACTTAGTGG - Intergenic
1089694958 11:120211195-120211217 CAAACTTCGCCCAAAGTTGGGGG - Exonic
1089977291 11:122743424-122743446 CAAGCTAGTCTCAAACTTCTGGG + Intronic
1090174962 11:124640507-124640529 CAAGCTACCCCAAAACTTAGGGG - Intronic
1090452935 11:126822575-126822597 CAAACTACCCCAAAACTTAGTGG + Intronic
1090943786 11:131411671-131411693 TATTCTTCTCCCAAACTTGGAGG + Intronic
1091161134 11:133421910-133421932 AAACCTACTCCCAAGATTGGAGG - Intronic
1091941132 12:4483387-4483409 CAAACCACTCCAAAACTTAGTGG - Intergenic
1092377501 12:7968015-7968037 CAAGCTAGTCTCAAACTTGTAGG + Intergenic
1095487051 12:42696029-42696051 CAAACCACTCCCAAACTTGATGG - Intergenic
1097612661 12:61843695-61843717 GAATCTACTTCCAAACTTGAAGG - Intronic
1097959513 12:65518815-65518837 CAAACTACTCCAAAACTTAGTGG - Intergenic
1098233849 12:68399309-68399331 CAAATTACTCCAAAACTTAGTGG - Intergenic
1099222079 12:79926984-79927006 CAAGCTAGTCTCAAACTTCTGGG - Intronic
1100691205 12:97040202-97040224 CAAACTACTCCAAAACTTAGTGG + Intergenic
1100755431 12:97746128-97746150 CAAATTACTCCAAAACTTAGTGG - Intergenic
1101693885 12:107106528-107106550 CAAGCTACTCCAAAATTGCGTGG - Intergenic
1102603148 12:114048299-114048321 AAACTTACTCCAAAACTTGGTGG - Intergenic
1102740845 12:115206189-115206211 CAAACTACCCCCAAACTTAGTGG - Intergenic
1102797974 12:115705803-115705825 CAAACCACTCCAAAACTTGATGG - Intergenic
1104594195 12:130109179-130109201 CAAACTACTCTGAAACTTAGTGG - Intergenic
1105672047 13:22629858-22629880 CAAGCTAAGCCCCAACTTTGGGG + Intergenic
1107034199 13:35883455-35883477 CAAGCTACTTCCACTCATGGTGG - Intronic
1107883181 13:44851588-44851610 CAAGCTACTACCGCACTTTGGGG + Intergenic
1107996030 13:45861958-45861980 CAAATTACTCCAAAACTTGGTGG - Intergenic
1108359494 13:49656369-49656391 CAAGCTGGTCTCAAACTTGTGGG - Intergenic
1110385338 13:74904342-74904364 CAAGTTACTGCCAAACTTACTGG - Intergenic
1110753538 13:79144794-79144816 CAAACCACTCCAAAACTTAGTGG + Intergenic
1111971712 13:94923738-94923760 CAAACGACTCCAAAACTTAGTGG - Intergenic
1112784926 13:102941039-102941061 CAAACTACTCCAAAACTCTGTGG - Intergenic
1115123282 14:29962621-29962643 CAAGCTACTCCAAGACTTGGTGG - Intronic
1115591511 14:34870105-34870127 CAACCTACCCCAAAACTTGGTGG - Intronic
1117030716 14:51666922-51666944 CAAGCTGGTCTCAAACTTCGGGG - Intronic
1118182957 14:63511532-63511554 CAAACCACTCCAAAACTTGGTGG - Intronic
1118642042 14:67801979-67802001 CACCCCACTCCCAATCTTGGTGG + Intronic
1118875946 14:69785001-69785023 AAAGCTGCTGCCAAACTTTGGGG + Intronic
1119126179 14:72129490-72129512 CAAACTACTCCAACACTTAGTGG + Intronic
1120578016 14:86207967-86207989 CAAGCTAAGCCCCAATTTGGGGG + Intergenic
1124475001 15:30025625-30025647 CCAGCTACTCCCAGATCTGGGGG - Intergenic
1124585206 15:30998713-30998735 CAAGTGACTCCAAAACTGGGTGG - Intergenic
1125283043 15:38063481-38063503 CAAGCAGCTCACAAACTTGTTGG + Intergenic
1126151743 15:45529241-45529263 AAACCTACTCCCAAACCCGGTGG - Intergenic
1126730974 15:51681807-51681829 CAAGCTTTCCCCAAACCTGGAGG + Exonic
1126741529 15:51781414-51781436 CAAATTACTCCAAAACTTAGAGG + Intronic
1127177676 15:56378260-56378282 CAAACTATTCCAAAAATTGGAGG - Intronic
1128096307 15:64959115-64959137 CACGCTACTCCCCAAGGTGGGGG - Intergenic
1128114853 15:65098841-65098863 CAAACTACCCCGAAACTTAGTGG - Intronic
1130361746 15:83194000-83194022 CAAGCTAAGCCCCAATTTGGGGG + Intronic
1131079733 15:89524633-89524655 CAGGATACTCCCATACTTGGAGG + Intergenic
1132003508 15:98204341-98204363 CAAGTTTCTTCCAAACTTAGTGG + Intergenic
1134491613 16:14700149-14700171 CCAGCTACTCCCAACCTGGGAGG - Intergenic
1134496994 16:14739267-14739289 CCAGCTACTCCCAACCTGGGAGG - Intronic
1134749895 16:16617666-16617688 CAAGCTAAGCCCCAACTTTGGGG - Intergenic
1134995581 16:18735949-18735971 CAAGCTAAGCCCCAACTTTGGGG + Intergenic
1135100728 16:19602973-19602995 CAAGCTGCTCTCAAACTTCTGGG + Intronic
1135524824 16:23206241-23206263 CAAGCTATTCCCAGACAAGGTGG - Intronic
1135852001 16:25972284-25972306 CAAATTACCCCAAAACTTGGTGG + Intronic
1137909001 16:52356594-52356616 CAAACTGCTCCAAAACTTAGTGG - Intergenic
1138681701 16:58688337-58688359 AAACCTTCCCCCAAACTTGGAGG - Intergenic
1139133370 16:64172816-64172838 CAAACTACACCAAAACTTGGTGG - Intergenic
1139140099 16:64251731-64251753 CAAGCCACTCCACAACTTAGTGG + Intergenic
1140066274 16:71614191-71614213 CAAATCACTCCCAAACTTAGAGG + Intergenic
1141276792 16:82595661-82595683 CAAACCACTCCCAAATTTAGTGG + Intergenic
1144580921 17:16458913-16458935 CAAACTACCCCAAAACTTAGTGG - Intronic
1145066344 17:19763878-19763900 CAAGCCACTCCAAAACTTAATGG - Intergenic
1145414512 17:22703821-22703843 CAAGATTCTCCCAAACTGAGCGG - Intergenic
1147112718 17:38275498-38275520 CAGGCTGGTCTCAAACTTGGGGG - Intergenic
1148226925 17:45905614-45905636 CAAGCTACTCCCTCATTTGTGGG + Intronic
1148357243 17:46983622-46983644 CAAACTACAACCAAACTTGCTGG - Intronic
1148416907 17:47513741-47513763 CAGGCTGGTCTCAAACTTGGGGG + Intergenic
1149450237 17:56744486-56744508 CAAACTACTCTGAAACTTAGTGG + Intergenic
1149561683 17:57611929-57611951 CAAACTGCCCCCAAACTTAGTGG - Intronic
1149578683 17:57732099-57732121 CAAGCTACTTCAAAACTTAATGG + Intergenic
1152141339 17:78538618-78538640 CAGGCTACTCACAAAGTAGGAGG + Intronic
1152201719 17:78951139-78951161 CAAGTTACCCCAAAACTTAGAGG - Intergenic
1152203950 17:78963681-78963703 CAAACTGCTCCAAAACTCGGTGG - Intergenic
1153601047 18:6781637-6781659 CTAGATCCTCCCAAACTTCGTGG + Intronic
1153961123 18:10141055-10141077 CAACCTCATCCCAAGCTTGGTGG + Intergenic
1154167502 18:12027096-12027118 AAAGCCACTCCCAAAGTCGGGGG - Intronic
1156277270 18:35595340-35595362 CTAGCAACTCCCAGACTTGTGGG + Intronic
1156295748 18:35789145-35789167 CAGGCTAGTCCCAAACTTCCAGG + Intergenic
1157643272 18:49239846-49239868 CAAACTACCCCAAAACTTAGTGG - Intronic
1159185993 18:64974940-64974962 CAAGCTAAGCCCGAATTTGGGGG + Intergenic
1161884547 19:6983837-6983859 CAAGCTACTCACAAGGTTGCTGG - Intergenic
1164008281 19:21172588-21172610 CAGGCTAGTCTCAAACTTTGGGG - Intronic
1164969326 19:32517637-32517659 CAAAGTACTCCAAAACTTAGTGG + Intergenic
1166020052 19:40018942-40018964 CAAACTACTCCAAAACTTAGTGG - Intergenic
1166379609 19:42349087-42349109 CAGGCTAGTCCCAAACTTCTGGG - Intronic
1166901868 19:46070722-46070744 AAAGCTCCTCTCAAACATGGAGG + Intronic
1167179958 19:47895501-47895523 CAAACCACCCCCAAACTTAGTGG + Intergenic
1167573158 19:50303080-50303102 CAAACTACTCTGAAACTTAGTGG + Intronic
1168397956 19:56065053-56065075 CAAGCCCCTCCCACACTTGAGGG + Intergenic
926709586 2:15867825-15867847 CAAACTGCCCCCAAACTTAGTGG - Intergenic
926893364 2:17658142-17658164 CAACCTACCCCCAAACCTAGTGG + Intergenic
928447857 2:31348920-31348942 AAAGCTTATTCCAAACTTGGTGG + Exonic
928539644 2:32272379-32272401 CAAGCTGCTGGCAAATTTGGTGG - Intergenic
928736428 2:34296151-34296173 CAAGCTAATCTCAAAGTTAGAGG - Intergenic
929343304 2:40849699-40849721 CAAGCAACCCCCAAATTTAGTGG + Intergenic
932063946 2:68533449-68533471 CAAGCTACTCCAACTCTTAGTGG + Intronic
932909642 2:75792196-75792218 CAAACCACTCCAAAACTTAGTGG + Intergenic
933198033 2:79414971-79414993 CAAACTGCCCCAAAACTTGGTGG - Intronic
935420201 2:102859724-102859746 CAAACTACTCCCAAATTTTAAGG + Intergenic
937064263 2:119005419-119005441 CAAGCCACCCCCAAACCTAGTGG - Intergenic
942212070 2:173681265-173681287 CAAGCCCCTCCAAAACTTAGTGG + Intergenic
944417919 2:199497249-199497271 CAAGCCACCCTCAAACTTAGTGG - Intergenic
944930535 2:204514236-204514258 CAAACTACCCTCAAACTTAGTGG - Intergenic
945794805 2:214348845-214348867 CAAACTGCTCCAAAACTTAGAGG - Intronic
946012578 2:216578114-216578136 CAAGCCACTGCAAAACTTAGTGG + Intronic
946139669 2:217678977-217678999 CAAACTACCCTAAAACTTGGTGG - Intronic
948678703 2:239615599-239615621 CAAACCACTCCAAAACTTAGTGG - Intergenic
1169138498 20:3212529-3212551 CAAGCTAGTCTCAAACTTCTGGG + Intronic
1170272825 20:14547683-14547705 CAAACCACTCCAAAACTTGGTGG + Intronic
1170352921 20:15461782-15461804 CAAGCCACCCAGAAACTTGGTGG + Intronic
1170356338 20:15496112-15496134 CAAGCCACTCCCCAAGTTAGTGG - Intronic
1170579438 20:17686801-17686823 CAAACCACTCCCAAACTCAGTGG + Intergenic
1170819646 20:19745701-19745723 CAAACTACCCCTAAACTTAGTGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1172590329 20:36113173-36113195 AAAGCTTCTTCCCAACTTGGAGG + Intronic
1172959785 20:38790482-38790504 CCAACTACTCCAAAACTTAGAGG - Intergenic
1173466352 20:43285059-43285081 CAAGCTAATCCCCAAGTTTGGGG - Intergenic
1173505460 20:43583645-43583667 CAAGCAACTCCAAAGCTAGGTGG + Intronic
1173532348 20:43779956-43779978 CAAGCTACTCCCAAAAGTCTGGG - Intergenic
1177256559 21:18670613-18670635 CAAACTACTCCAAAAAATGGAGG + Intergenic
1177329581 21:19640732-19640754 TAAATTATTCCCAAACTTGGTGG + Intergenic
1177785712 21:25669160-25669182 CAAGCTGGTCTCAAACTTGTGGG - Intronic
1178472046 21:32902622-32902644 CAAGCCACGCCCAAACTGCGAGG - Intergenic
1179342716 21:40527676-40527698 CAAACTACTTCAAAACTTAGTGG - Intronic
1182029627 22:27147689-27147711 CAAGCTAAACCCCAATTTGGGGG + Intergenic
1182678526 22:32059787-32059809 GAAGCTACTCAAAATCTTGGTGG - Intronic
1182918921 22:34061522-34061544 CAATCCACTCCAAAACTTTGTGG - Intergenic
1182964822 22:34511124-34511146 CAAGTTTAACCCAAACTTGGGGG + Intergenic
1183007861 22:34918386-34918408 CAAACTACCCCCAAACTCTGTGG + Intergenic
1183029292 22:35091260-35091282 CAAACTACCCCAAAACTTAGTGG + Intergenic
1183101537 22:35587164-35587186 CAAGGTACTCCAAAACGTAGTGG - Intergenic
949164115 3:916966-916988 CAAGGTACTCCCTAACTATGTGG - Intergenic
949308956 3:2674121-2674143 CAAACTACTCCAAAACTGAGCGG - Intronic
949913884 3:8941219-8941241 AAAGCTACTGCCATACTTGAAGG + Intronic
950103275 3:10371490-10371512 CAAACTACTCCAAAACTTAGTGG - Intronic
950872440 3:16241507-16241529 CAAACTACCCCAAAACTTAGTGG + Intergenic
950932682 3:16806269-16806291 GAAGCCACTCCAAAACTTAGTGG - Intronic
951578772 3:24140302-24140324 CAAACTAACCCCAAACTTTGTGG + Intronic
952302245 3:32113686-32113708 CAGTCTACCCCCAAACTTAGTGG + Intronic
952496733 3:33922611-33922633 CAAGCCACTTCAACACTTGGTGG + Intergenic
953597707 3:44334081-44334103 CTAGTTACTTCCAAATTTGGGGG + Intergenic
953687519 3:45089691-45089713 CAAACTACCCCAAAATTTGGTGG - Intronic
954783296 3:53075662-53075684 CCAGCAACTCCCAGTCTTGGTGG - Intronic
956051177 3:65250041-65250063 CAAGTTGCTCCTAAGCTTGGAGG - Intergenic
956764372 3:72472103-72472125 CAAATTACTCCAAAACTTAGTGG + Intergenic
959570533 3:107878323-107878345 CAAACCACTCCCAAACTTGGTGG - Intergenic
961421403 3:126807793-126807815 CAAATTACTCCAAAACTTAGTGG + Intronic
962550769 3:136488441-136488463 CAAATTACTCCCAAACTTGGTGG - Intronic
963036206 3:141031320-141031342 AAACCTACTCCAAAACTTGATGG + Intergenic
963218773 3:142782453-142782475 CAAACTACTCTGAAACTTAGTGG + Intronic
963231783 3:142915565-142915587 CAAGAAACTCACAATCTTGGAGG + Intergenic
963267596 3:143254527-143254549 CAAACTACCCCCAAATTTAGTGG + Intergenic
964254232 3:154757232-154757254 CAAGCTATTCCAAAAAATGGAGG + Intergenic
965075685 3:163972339-163972361 CAAATTACTCCAAAACTTAGTGG - Intergenic
965766269 3:172133782-172133804 CAAATTACTCCAAAATTTGGTGG + Intronic
967136542 3:186517228-186517250 CAAACCACTCCCAAACATGGTGG - Intergenic
967252983 3:187562231-187562253 CAAATTACTCCAACACTTGGTGG + Intergenic
967313881 3:188132313-188132335 CAAACCAATCCCAAATTTGGGGG + Intergenic
967726596 3:192868088-192868110 AAAACTACCCCCAAACTTAGTGG - Intronic
967808716 3:193737208-193737230 GAAGCTATTCCCAAAGTTGCAGG - Intergenic
967835382 3:193958276-193958298 CAGCCGACTCCCAAACCTGGAGG - Intergenic
967933412 3:194707126-194707148 CAAGATACCCCCAAAGTAGGGGG - Intergenic
968438768 4:610810-610832 CAAACTGCTCCCAAATTTAGTGG - Intergenic
970650502 4:18172139-18172161 CAAGCTACTCCAAAATGTAGTGG - Intergenic
971925244 4:33001387-33001409 CAAGTTACTCCAAAACTTGGTGG + Intergenic
972116324 4:35638868-35638890 CAAGCCACTCCAAAACTCAGTGG - Intergenic
972246833 4:37253762-37253784 CAATCTACTTCAAAACTTAGTGG - Intronic
976202938 4:82597758-82597780 CAAACTACTCCAAAACTTAATGG - Intergenic
977105413 4:92876814-92876836 CAAGCTAATTCCAATGTTGGTGG + Intronic
977725843 4:100296138-100296160 CAAGCTACTTCAAAACTTAGTGG + Intergenic
978016533 4:103752830-103752852 CATGCCACTCCCCATCTTGGTGG + Intergenic
978063036 4:104362346-104362368 CAAGTTATTCCCAAAGTTAGCGG + Intergenic
978716511 4:111849937-111849959 GAAATTACTCCCAAACTTAGGGG + Intergenic
979158964 4:117434514-117434536 CAAATTACTCCCAAACTTACTGG + Intergenic
981849781 4:149216685-149216707 CAAACTACTCCAAAACTTAATGG - Intergenic
983186362 4:164705660-164705682 CAACCTACCCCGAAACTTAGGGG + Intergenic
983328350 4:166289688-166289710 AAAGCTACCCCCAAACCTAGTGG + Intergenic
984786827 4:183574821-183574843 CAAACTACTCCGAAACTTAGTGG - Intergenic
985786594 5:1898510-1898532 CAAGCTTTTCCCAATTTTGGTGG - Intergenic
986212100 5:5683587-5683609 TAAGCTACTCCAAAACATAGTGG - Intergenic
986409645 5:7464533-7464555 CAAGCTACCCCCAATCTAGGTGG - Intronic
988682854 5:33501160-33501182 CAAACTACCCCAAAACTTGGTGG + Intergenic
990430495 5:55730236-55730258 CAAACTACTCCAAAACTTGGTGG - Intronic
991040731 5:62172857-62172879 CAAACTACTCCAAAACTCAGTGG + Intergenic
991292934 5:65050374-65050396 CAAGGTGCTCACAAATTTGGTGG + Intergenic
993361431 5:86981462-86981484 CAAACTACACCAAAACTTTGTGG - Intergenic
998261766 5:140637141-140637163 CACCCTACTCCCACTCTTGGGGG - Intergenic
999889261 5:155958975-155958997 CAATAAACTCCCAAATTTGGGGG - Intronic
999924077 5:156356143-156356165 CAAACTACCCCAAAACTTAGTGG + Intronic
1005641057 6:27796716-27796738 CAAGCTAGCCCCAAACTTGATGG - Intergenic
1007132288 6:39486541-39486563 CAAACTATTCCAAAACTTGGTGG - Intronic
1007811784 6:44491424-44491446 CAAACTACCCCAAAACTTAGTGG - Intergenic
1011173225 6:84529924-84529946 CAAGCTACCTGAAAACTTGGTGG + Intergenic
1012206480 6:96466908-96466930 CAAATTACTCCAAAACTTTGTGG - Intergenic
1013135357 6:107277026-107277048 CAAACTACTCCAAACCTTGGTGG - Intronic
1013594912 6:111651751-111651773 CAAACCACTCCAAAACTTAGTGG - Intergenic
1013614769 6:111831997-111832019 CACGCTACACCCAAAGTTTGAGG + Intronic
1013910929 6:115275008-115275030 CAAATTACTCCTAAACTTAGTGG - Intergenic
1014102950 6:117531851-117531873 CAAGCCACTCCAAAACTTAGTGG + Intronic
1014357224 6:120427777-120427799 CCAGCTACTCCAAAAGCTGGAGG + Intergenic
1014587772 6:123221907-123221929 CAAAATAATCCCAAATTTGGAGG + Intronic
1015286770 6:131494474-131494496 AAAACTACTCCAAAACTTAGTGG + Intergenic
1017166587 6:151413558-151413580 CAAATTACCCCAAAACTTGGTGG - Intronic
1017274421 6:152549381-152549403 CAAACTACTCCAAAACTCTGTGG - Intronic
1018396082 6:163379063-163379085 CAAGCCTCCCCCAATCTTGGAGG - Intergenic
1018772582 6:166984936-166984958 CAAATTACTCCAAAACTTAGTGG + Intergenic
1018882889 6:167903174-167903196 CAAACCACTCCAAAACTTTGTGG + Intronic
1019089253 6:169513040-169513062 TAAACTACTCTCAAACTTAGTGG + Intronic
1021399430 7:20192674-20192696 CAAACTACTCCAAAACTTAGTGG - Intronic
1021461689 7:20894547-20894569 CAAACTACTACGAAATTTGGTGG - Intergenic
1021709334 7:23399611-23399633 CAAATTAATCACAAACTTGGTGG - Intronic
1021831403 7:24615660-24615682 CAAACTATTCCAAAAATTGGAGG + Intronic
1021845749 7:24761059-24761081 CAAACTACCCCAAAACTTAGTGG + Intergenic
1027053052 7:75031715-75031737 CAAGTTGCCCCCAAACTTAGCGG + Intronic
1028013777 7:85681561-85681583 CAATCTACTGCCAAACCTTGAGG + Intergenic
1028250653 7:88536063-88536085 CAAACTACCCCAAAACTTAGTGG - Intergenic
1029048067 7:97652339-97652361 CCAGCTACCCCAAAACTTAGAGG - Intergenic
1029902505 7:104056489-104056511 CAAGCCACTCTAAAACTTAGTGG + Intergenic
1030201962 7:106914818-106914840 CAAATTATCCCCAAACTTGGTGG - Intergenic
1030351485 7:108493119-108493141 CAAGCCACTCCAAAACTTAGTGG - Intronic
1030996766 7:116368820-116368842 CAAGCTACTCTCATACTTGATGG - Intronic
1032204209 7:129847550-129847572 CAAGCTAGTCCCAAACTCCAAGG + Intronic
1033112144 7:138589653-138589675 CCAGCCACTCCCAAAGTAGGAGG + Exonic
1034125942 7:148671741-148671763 CAAATTACCCCAAAACTTGGTGG + Intergenic
1037013478 8:13874230-13874252 CAAGATACTTCCTAACTTGAGGG + Intergenic
1037602807 8:20412328-20412350 CAAACTACTCCCAAACTTAGTGG + Intergenic
1041692498 8:60702734-60702756 CAAACTACACTGAAACTTGGTGG + Intronic
1041757120 8:61326225-61326247 CAAGCTACATCAAAACTTAGTGG + Intronic
1042364835 8:67924214-67924236 CAAGCCACCCCAAAACTTAGTGG + Intergenic
1042394384 8:68275351-68275373 CAGGCTGCTCTCAAACTTTGGGG + Intergenic
1044830049 8:96238402-96238424 CAAACTACCCCCAAAGTTAGCGG + Intergenic
1045346284 8:101296795-101296817 CAAACTACCCCCAAATTTAGAGG + Intergenic
1046943794 8:119956149-119956171 CAAGCTACTCCCAAACTTGGTGG - Intronic
1048151197 8:131896476-131896498 CTAACCACTCCCAAACTTAGTGG + Intergenic
1048326765 8:133445791-133445813 CAAACTACTCCAAACCTTAGTGG + Intergenic
1048473035 8:134720293-134720315 AAAACTACTCCCACACTTAGTGG - Intergenic
1048658652 8:136571830-136571852 CATGCAACTCCCAAATTCGGTGG - Intergenic
1051013727 9:12450139-12450161 CAAATTACTCCAAAAGTTGGCGG + Intergenic
1051674994 9:19549848-19549870 CAAACTACCCCAAAACTTAGTGG - Intronic
1052318774 9:27144639-27144661 CAAGCTACTTCCCAAATAGGTGG + Intronic
1055209712 9:73776035-73776057 CAGGCTGCTCCCAAACTTCTGGG - Intergenic
1057102162 9:92372579-92372601 CAAGGAAGTCCTAAACTTGGAGG - Intronic
1057569074 9:96190075-96190097 CAAACTACTTCAAAACTTAGTGG + Intergenic
1058825590 9:108773631-108773653 CAAACTACCCCAAAATTTGGTGG + Intergenic
1060143789 9:121233709-121233731 CAAACCACTCCAAAACTTTGTGG - Intronic
1060275718 9:122180831-122180853 CAAGCTGCTCCCAGACTTGTGGG - Intronic
1060428696 9:123528355-123528377 CAAGCAACTCCCAGTCCTGGAGG - Intronic
1060567079 9:124602489-124602511 AAAGCAAGTCTCAAACTTGGGGG + Intronic
1186491695 X:9978898-9978920 CAAGTTTCTCCCAGACTTGAAGG + Intergenic
1187920527 X:24196880-24196902 CAACCTACAGCCAAACATGGTGG - Intronic
1189139412 X:38585877-38585899 CAGGCTACTTCCACACATGGTGG - Intronic
1189241447 X:39527639-39527661 CAAGTCATTCCCAAACTTAGTGG - Intergenic
1189355909 X:40309798-40309820 CAAGCTACCCCCAAACTAAGTGG - Intergenic
1189465325 X:41274127-41274149 CAAGCCACCCCAAAACTTAGTGG - Intergenic
1189571460 X:42302244-42302266 CAAGTTACTCCAAAATTTAGTGG - Intergenic
1189589064 X:42492724-42492746 CAAGCCACTCCAAAACCTAGTGG - Intergenic
1192297060 X:69861971-69861993 CAAATTACTCCAAAACTTAGTGG + Intronic
1194381232 X:93193629-93193651 TAACATAGTCCCAAACTTGGAGG - Intergenic
1194411609 X:93564975-93564997 CAATCTTCCCCCAAATTTGGAGG - Intergenic
1195230023 X:102837330-102837352 CAAGCCACTACCATAATTGGAGG + Intergenic
1195979921 X:110566840-110566862 CAAGTTACCCCAAAACTTAGTGG + Intergenic
1196299213 X:114035791-114035813 CAAACTACCCCAAAACATGGTGG + Intergenic
1199590055 X:149459219-149459241 CAAACTACCCCCAAACTTAGTGG - Intergenic
1199885988 X:152022406-152022428 CAAACTACCCCAAAACGTGGCGG - Intergenic