ID: 1046952612

View in Genome Browser
Species Human (GRCh38)
Location 8:120032585-120032607
Sequence GTGACCTTGTTGGCTGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046952602_1046952612 15 Left 1046952602 8:120032547-120032569 CCCGAGTGGGACCACAAGTGAAG 0: 1
1: 0
2: 1
3: 7
4: 96
Right 1046952612 8:120032585-120032607 GTGACCTTGTTGGCTGGTGGGGG No data
1046952601_1046952612 25 Left 1046952601 8:120032537-120032559 CCTGAAGGTTCCCGAGTGGGACC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1046952612 8:120032585-120032607 GTGACCTTGTTGGCTGGTGGGGG No data
1046952605_1046952612 4 Left 1046952605 8:120032558-120032580 CCACAAGTGAAGCTGGTGATGAA 0: 1
1: 0
2: 2
3: 12
4: 154
Right 1046952612 8:120032585-120032607 GTGACCTTGTTGGCTGGTGGGGG No data
1046952603_1046952612 14 Left 1046952603 8:120032548-120032570 CCGAGTGGGACCACAAGTGAAGC 0: 1
1: 0
2: 2
3: 9
4: 98
Right 1046952612 8:120032585-120032607 GTGACCTTGTTGGCTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046952612 Original CRISPR GTGACCTTGTTGGCTGGTGG GGG Intronic
No off target data available for this crispr